Variant #0000931239 (NC_000022.10:g.17663696_17663722del, NC_000022.10(NM_017424.2):c.1082-42_1082-16del (CECR1))
Chromosome |
22 |
Allele |
Unknown |
Affects function (as reported) |
Probably does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
likely benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.17663696_17663722del |
DNA change (hg38) |
- |
Published as |
ADA2(NM_001282225.2):c.1082-42_1082-16delGACCCATCCATCCCCCATGGAAGACCA |
ISCN |
- |
DB-ID |
CECR1_000047 |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Groningen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Groningen |
Date created |
2023-07-07 10:10:56 +02:00 (CEST) |
Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|