Variant #0000932890 (NC_000017.10:g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678], NM_018149.6:c.? (SMG8))
Individual ID |
00436106 |
Chromosome |
17 |
Allele |
Parent #1 |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic (dominant) |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
DNA change (hg38) |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
Published as |
RP17_SV3 |
ISCN |
- |
DB-ID |
GDPD1_000003 See all 6 reported entries |
Variant remarks |
- |
Reference |
PubMed: De Bruijn 2020, Journal: De Bruijn 2020 |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
Germline |
Segregation |
yes |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Suzanne de Bruijn |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
Johan den Dunnen |
Date created |
2023-07-21 22:11:28 +02:00 (CEST) |
Date last edited |
2023-08-23 14:39:16 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|