Variant #0000939702 (NC_000006.11:g.157292077_qterdelins[TCTGCAGAAAGTATAGGTCTGAT;NC_000001.10:g.pter_73895566inv], NC_000006.11(NM_001374828.1):c.2037+35367_*2888delins[TCTGCAGAAAGTATAGGTCTGAT;NC_000001.10:g.pter_73895566inv] (ARID1B))
| Individual ID |
00440287 |
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (dominant) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.157292077_qterdelins[TCTGCAGAAAGTATAGGTCTGAT;NC_000001.10:g.pter_73895566inv] |
| DNA change (hg38) |
- |
| Published as |
- |
| ISCN |
46,XY,t(1;6)(p31;q25)dn |
| DB-ID |
ARID1B_000443 |
| Variant remarks |
- |
| Reference |
PubMed: Halgren 2012 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
De novo |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Genomic location of variant could not be determined |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2023-10-31 19:36:26 +01:00 (CET) |
| Date last edited |
2023-10-31 19:39:51 +01:00 (CET) |
Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|