Variant #0000939712 (NC_000001.10:g.[NC_000006.11:g.157292077_qterdel]ins[TCTGCAGAAAGTATAGGTCTGAT;pter_73895566inv])
| Individual ID |
00440287 |
| Chromosome |
1 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (dominant) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.[NC_000006.11:g.157292077_qterdel]ins[TCTGCAGAAAGTATAGGTCTGAT;pter_73895566inv] |
| DNA change (hg38) |
- |
| Published as |
46,XY,t(1;6)(p31;q25)dn |
| ISCN |
- |
| DB-ID |
chr1_015568 |
| Variant remarks |
- |
| Reference |
PubMed: Halgren 2012 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
DUPLICATE record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Genomic location of variant could not be determined |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2023-10-31 19:49:22 +01:00 (CET) |
| Date last edited |
N/A |
Variant on transcripts
Screenings
|