Variant #0000949219 (NC_000009.11:g.136419687_136419716del, NM_001145320.1:c.1148_1177del (ADAMTSL2))
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.136419687_136419716del |
| DNA change (hg38) |
- |
| Published as |
ADAMTSL2(NM_001145320.1):c.1148_1177delACCGGCTGTTCGGCCACCCGGGCCTGGACA (p.N383_D392del), ADAMTSL2(NM_014694.4):c.1148_1177del (p.(Asn383_Asp392del))... |
| ISCN |
- |
| DB-ID |
ADAMTSL2_000015 See all 4 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2023-11-27 17:35:39 +01:00 (CET) |
| Date last edited |
2025-05-05 21:14:00 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|