Variant #0000959858 (NC_000021.8:g.36042473_36042502del, NM_053277.1:c.786_815del (CLIC6))
| Individual ID |
00447962 |
| Chromosome |
21 |
| Allele |
Both (homozygous) |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.36042473_36042502del |
| DNA change (hg38) |
g.34670174_34670203del |
| Published as |
CLIC6 776_805delGCGTAGAAGCGGGGGTCCCGGCGGGGGACA |
| ISCN |
- |
| DB-ID |
CLIC6_000004 See all 2 reported entries |
| Variant remarks |
- |
| Reference |
PubMed: Chia 2018 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2024-02-09 10:36:02 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|