Variant #0000960535 (NC_000001.10:g.154842222_154842242del, NM_002249.5:c.221_241del (KCNN3))
| Chromosome |
1 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.154842222_154842242del |
| DNA change (hg38) |
- |
| Published as |
KCNN3(NM_002249.6):c.221_241delAGCAGCAGCAGCAGCAGCAGC (p.Q74_Q80del) |
| ISCN |
- |
| DB-ID |
KCNN3_000028 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2024-02-26 20:06:56 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|