Variant #0000963977 (NC_000006.11:g.30997559_30997588dup, NM_001198815.1:c.4351_4380dup (MUC22))
| Chromosome |
6 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.30997559_30997588dup |
| DNA change (hg38) |
- |
| Published as |
MUC22(NM_001198815.1):c.4351_4380dupGCAGGCTCTGAGACCACCACAGCCTCCACT (p.A1451_T1460dup) |
| ISCN |
- |
| DB-ID |
MUC22_000015 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2024-02-26 20:06:56 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|