Variant #0000968814 (NC_000017.10:g.34171725_34171748del, NM_139215.2:c.1422_1445del (TAF15))
| Chromosome |
17 |
| Allele |
Unknown |
| Affects function (as reported) |
Does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.34171725_34171748del |
| DNA change (hg38) |
- |
| Published as |
TAF15(NM_139215.3):c.1422_1445delCCGAGGAGGTGGCTATGGAGGAGA (p.G478_G485del) |
| ISCN |
- |
| DB-ID |
TAF15_000006 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
0.00443 View details |
| Owner |
VKGL-NL_VUmc |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_VUmc |
| Date created |
2024-02-26 20:06:56 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|