Variant #0000990160 (NC_000001.10:g.11897186_11897214dup, NM_005957.4:c.-31276_-31248dup (MTHFR))
| Chromosome |
1 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.11897186_11897214dup |
| DNA change (hg38) |
- |
| Published as |
CLCN6(NM_001286.3):c.2111_2138+1dupACCTCCTGCAGCAGATGCTGGAAAGGAGG (p.?) |
| ISCN |
- |
| DB-ID |
MTHFR_000130 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Leiden |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Leiden |
| Date created |
2024-08-28 13:07:21 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|