Variant #0000993405 (NC_000003.11:g.157823616_157823636dup, NM_003030.4:c.207_227dup (SHOX2))
| Chromosome |
3 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.157823616_157823636dup |
| DNA change (hg38) |
- |
| Published as |
SHOX2(NM_001163678.1):c.207_227dupCGGCGGCGGAGGAGGCGGAGG (p.(Gly70_Gly76dup)) |
| ISCN |
- |
| DB-ID |
SHOX2_000021 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Leiden |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Leiden |
| Date created |
2024-08-28 13:16:32 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|