Variant #0000994344 (NC_000004.11:g.5667359_5667384del, NC_000004.11(NM_147127.4):c.871-2_894del (EVC2))
| Chromosome |
4 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.5667359_5667384del |
| DNA change (hg38) |
- |
| Published as |
EVC2(NM_147127.4):c.871-2_894delAGGTTCTGCCGCACCACGGCCTCCAC (p.(Val291_Ala299del)) |
| ISCN |
- |
| DB-ID |
EVC2_000177 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Leiden |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Leiden |
| Date created |
2024-08-28 13:16:32 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|