Variant #0001006475 (NC_000023.10:g.139586507_139586527del, NM_005634.2:c.711_731del (SOX3))
| Chromosome |
X |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.139586507_139586527del |
| DNA change (hg38) |
- |
| Published as |
SOX3(NM_005634.2):c.711_731delCGCCGCCGCTGCCGCGGCCGC (p.(Ala238_Ala244del)), SOX3(NM_005634.3):c.711_731delCGCCGCCGCTGCCGCGGCCGC (p.A242_A248del) |
| ISCN |
- |
| DB-ID |
SOX3_000025 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Leiden |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Leiden |
| Date created |
2024-08-28 13:16:32 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|