Variant #0001006794 (NC_000023.10:g.48759551_48759571del, NM_005660.1:c.*1161_*1181del (SLC35A2))
Chromosome |
X |
Allele |
Unknown |
Affects function (as reported) |
Does not affect function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
benign |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.48759551_48759571del |
DNA change (hg38) |
- |
Published as |
PQBP1(NM_005710.2):c.334_354delAGGGGCCATGACAAGTCGGAC (p.G113_R119del) |
ISCN |
- |
DB-ID |
PQBP1_000017 See all 3 reported entries |
Variant remarks |
VKGL data sharing initiative Nederland |
Reference |
- |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
CLASSIFICATION record |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
VKGL-NL_Utrecht |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
VKGL-NL_Utrecht |
Date created |
2024-08-28 13:16:32 +02:00 (CEST) |
Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|