Variant #0001012178 (NC_000017.10:g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678], NM_018149.6:c.? (SMG8))
| Individual ID |
00456021 |
| Chromosome |
17 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (dominant) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.57516678_57516679ins[AAAAAAAACTTGAAAAAGAAGTTTG;57247620_57391675;57516683_57612715inv;GGTCCAGATTGTG;57499214_57516678] |
| DNA change (hg38) |
g.59439317_59439318ins[AAAAAAAACTTGAAAAAGAAGTTTG;59170259_59314314;59439322_59535354inv;GGTCCAGATTGTG;59421853_59439317] |
| Published as |
RP17_SV3 |
| ISCN |
- |
| DB-ID |
GDPD1_000003 See all 6 reported entries |
| Variant remarks |
- |
| Reference |
Journal: de Bruijn 2024 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Suzanne de Bruijn |
| Database submission license |
Creative Commons Attribution 4.0 International |
| Created by |
Suzanne de Bruijn |
| Date created |
2024-10-22 16:31:27 +02:00 (CEST) |
| Date last edited |
2024-10-24 16:09:16 +02:00 (CEST) |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|