Variant #0001014522 (NC_000009.11:g.140127594_140127623del, NC_000009.11(NM_080877.2):c.560+27_561-38del (SLC34A3))
| Chromosome |
9 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.140127594_140127623del |
| DNA change (hg38) |
- |
| Published as |
SLC34A3(NM_080877.2):c.560+27_561-38delTGGGGCTGCAGTGGCAGCCCCAGCCCGGGC |
| ISCN |
- |
| DB-ID |
RNF224_000029 |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Utrecht |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Utrecht |
| Date created |
2024-10-29 21:08:56 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|