Variant #0001021236 (NC_000001.10:g.100327867_100327892del, NM_000642.2:c.348_373del (AGL))
| Individual ID |
00460230 |
| Chromosome |
1 |
| Allele |
Parent #1 |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic (recessive) |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.100327867_100327892del |
| DNA change (hg38) |
g.99862311_99862336del |
| Published as |
c.348_373delTGCTGATAATCATGTGCTACCCTTGG |
| ISCN |
- |
| DB-ID |
AGL_000104 |
| Variant remarks |
- |
| Reference |
PubMed: Marti 2025 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
Germline |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
Johan den Dunnen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2025-01-22 12:23:09 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|