Variant #0001021236 (NC_000001.10:g.100327867_100327892del, NM_000642.2:c.348_373del (AGL))
Individual ID |
00460230 |
Chromosome |
1 |
Allele |
Parent #1 |
Affects function (as reported) |
Affects function |
Affects function (by curator) |
Not classified |
Classification method |
- |
Clinical classification |
pathogenic (recessive) |
DNA change (genomic) (Relative to hg19 / GRCh37) |
g.100327867_100327892del |
DNA change (hg38) |
g.99862311_99862336del |
Published as |
c.348_373delTGCTGATAATCATGTGCTACCCTTGG |
ISCN |
- |
DB-ID |
AGL_000104 |
Variant remarks |
- |
Reference |
PubMed: Marti 2025 |
ClinVar ID |
- |
dbSNP ID |
- |
Origin |
Germline |
Segregation |
- |
Frequency |
- |
Re-site |
- |
VIP |
- |
Methylation |
- |
Average frequency (gnomAD v.2.1.1) |
Retrieve |
Owner |
Johan den Dunnen |
Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
Created by |
Johan den Dunnen |
Date created |
2025-01-22 12:23:09 +01:00 (CET) |
Date last edited |
N/A |

Variant on transcripts
Screenings
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|