Variant #0001027303 (NC_000020.10:g.23615957_23615976del, NM_000099.2:c.277_296del (CST3))
| Chromosome |
20 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.23615957_23615976del |
| DNA change (hg38) |
- |
| Published as |
CST3(NM_000099.2):c.277_296del (p.(Glu93Tyrfs*14)), CST3(NM_000099.4):c.277_296delGAGCTGGGCCGAACCACGTG (p.E93Yfs*14) |
| ISCN |
- |
| DB-ID |
CST3_000013 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Utrecht |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Utrecht |
| Date created |
2025-02-07 18:57:27 +01:00 (CET) |
| Date last edited |
2025-11-01 13:22:20 +01:00 (CET) |

Variant on transcripts
|
Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.
|