Variant #0001046597 (NC_000017.10:g.17697114_17697134del, NM_030665.3:c.852_872del (RAI1))
| Chromosome |
17 |
| Allele |
Unknown |
| Affects function (as reported) |
Effect unknown |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
VUS |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.17697114_17697134del |
| DNA change (hg38) |
- |
| Published as |
RAI1(NM_030665.3):c.832_852del (p.(Gln285_Gln291del)), RAI1(NM_030665.3):c.852_872delGCAGCAGCAGCAGCAGCAGCA (p.Q285_Q291del), RAI1(NM_030665.4):c.85... |
| ISCN |
- |
| DB-ID |
RAI1_000024 See all 3 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Groningen |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Groningen |
| Date created |
2025-07-08 13:22:38 +02:00 (CEST) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|