Variant #0001054580 (NC_000013.10:g.20716680_20716700del, NM_021954.3:c.732_752del (GJA3))
| Chromosome |
13 |
| Allele |
Unknown |
| Affects function (as reported) |
Probably does not affect function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
likely benign |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.20716680_20716700del |
| DNA change (hg38) |
- |
| Published as |
GJA3(NM_021954.3):c.732_752delGGCCCCGCTGGGGACAGCCGA (p.E244_A250del), GJA3(NM_021954.4):c.732_752del (p.(Glu244_Ala250del)) |
| ISCN |
- |
| DB-ID |
GJA3_000028 See all 2 reported entries |
| Variant remarks |
VKGL data sharing initiative Nederland |
| Reference |
- |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
CLASSIFICATION record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
VKGL-NL_Leiden |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
VKGL-NL_Leiden |
| Date created |
2025-11-01 13:22:20 +01:00 (CET) |
| Date last edited |
N/A |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|