Variant #0000604119 (NC_000011.9:g.5247871_5247890del, NM_000518.4:c.237_256del (HBB))
| Chromosome |
11 |
| Allele |
Unknown |
| Affects function (as reported) |
Affects function |
| Affects function (by curator) |
Not classified |
| Classification method |
- |
| Clinical classification |
pathogenic |
| DNA change (genomic) (Relative to hg19 / GRCh37) |
g.5247871_5247890del |
| DNA change (hg38) |
g.5226641_5226660del |
| Published as |
CD 78/85 (-20bp), 237_256delGGACAACCTCAAGGGCACCT |
| ISCN |
- |
| DB-ID |
HBB_004102 |
| Variant remarks |
β-thalassaemia, Haemolytic anaemia, Ineffective erythropoiesis |
| Reference |
IthaNet-3225 |
| ClinVar ID |
- |
| dbSNP ID |
- |
| Origin |
SUMMARY record |
| Segregation |
- |
| Frequency |
- |
| Re-site |
- |
| VIP |
- |
| Methylation |
- |
| Average frequency (gnomAD v.2.1.1) |
Retrieve |
| Owner |
IthaNet - Petros Kountouris |
| Database submission license |
Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International |
| Created by |
Johan den Dunnen |
| Date created |
2019-11-08 15:46:08 +01:00 (CET) |
| Date last edited |
2020-06-29 18:00:09 +02:00 (CEST) |

Variant on transcripts
|
Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.
|