All variants in the ABCG2 gene

Information The variants shown are described using the NM_004827.2 transcript reference sequence.

13 entries on 1 page. Showing entries 1 - 13.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.133C>T r.(?) p.(Arg45*) - VUS g.89061015G>A - ABCG2(NM_004827.3):c.133C>T (p.(Arg45*)) - ABCG2_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.211A>G r.(?) p.(Met71Val) - likely benign g.89053780T>C - ABCG2(NM_001348985.1):c.211A>G (p.M71V) - ABCG2_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
./. - c.706C>T r.(?) p.(Arg236*) - VUS g.89039396G>A g.88118244G>A - - ABCG2_000005 - PubMed: Lhota 2016 - rs140207606 Germline - - - - - Zdenek Kleibl
?/. - c.706C>T r.(?) p.(Arg236*) - VUS g.89039396G>A g.88118244G>A - - ABCG2_000005 association; 1 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - - Germline - 1/2795 individuals - - - Mohammed Faruq
./. - c.736C>T r.(?) p.(Arg246*) - VUS g.89039366G>A g.88118214G>A - - ABCG2_000004 - PubMed: Lhota 2016 - rs200190472 Germline - - - - - Zdenek Kleibl
?/. - c.736C>T r.(?) p.(Arg246*) - VUS g.89039366G>A - ABCG2(NM_001348985.1):c.736C>T (p.R246*) - ABCG2_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.766C>T r.(?) p.(Leu256Phe) - VUS g.89039336G>A g.88118184G>A ABCG2(NM_004827.2):c.766C>T (p.L256F) - ABCG2_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1060G>A r.(?) p.(Gly354Arg) - likely benign g.89034589C>T - ABCG2(NM_001348985.1):c.1060G>A (p.G354R) - ABCG2_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1261A>G r.(?) p.(Thr421Ala) - VUS g.89028352T>C - ABCG2(NM_001348985.1):c.1261A>G (p.T421A) - ABCG2_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1787A>G r.(?) p.(Asn596Ser) - likely benign g.89015762T>C - ABCG2(NM_001348985.1):c.1787A>G (p.N596S) - ABCG2_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1820+1G>A r.spl? p.? - VUS g.89015728C>T - ABCG2(NM_001348985.1):c.1820+1G>A - ABCG2_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1855A>G r.(?) p.(Ile619Val) - VUS g.89013499T>C - - - ABCG2_000012 - - - rs1433787722 Unknown - - - - - MobiDetails
-/. - c.1930_1952dup r.(?) p.(Lys652ProfsTer3) - benign g.89013403_89013425dup g.88092251_88092273dup ABCG2(NM_004827.2):c.1930_1952dupGCCTACCTGAAATTGTTATTTCT (p.K652Pfs*3) - ABCG2_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.