All variants in the ABHD12 gene

This database is one of the "Eye disease" gene variant databases.
Information The variants shown are described using the NM_001042472.2 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. _1_1i c.-28544_192-20684delins[GTTAAGTTAAGTGTTGGGTTAAGTTAAGTTTCTT;NM_021067.3:75+2104_75+2166] r.0? p.0? - pathogenic g.25340671_25399883delins[25390635_25390697;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] g.25360035_25419247delins[25409999_25410061;AAGAAACTTAACTTAACCCAACACTTAACTTAAC] 1-192_oGINS1:c.327+1052del - ABHD12_000005 59 kb deletion PubMed: Chen 2013 - - Germline yes - - 0 - Dong-Hui Chen
Legend   How to query