All transcript variants in gene AMOT

Information The variants shown are described using the NM_133265.2 transcript reference sequence.

26 entries on 1 page. Showing entries 1 - 26.



AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. - c.-356+7237_-356+7238del - - p.(=) g.112068284_112068285del g.112825056_112825057del - - AMOT_000001 - - - - Germline - - - - - Yu Sun
-?/. - c.-355-6814C>G likely benign r.(=) p.(=) g.112065919G>C - AMOT(NM_001113490.1):c.436C>G (p.R146G) - AMOT_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.-347A>C VUS r.(?) p.(=) g.112059097T>G - AMOT(NM_001113490.1):c.881A>C (p.(Gln294Pro)) - AMOT_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.-125G>A likely benign r.(?) p.(=) g.112058875C>T - AMOT(NM_001113490.1):c.1103G>A (p.(Arg368His)) - AMOT_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.-35_-33dup VUS r.(?) p.(=) g.112058796_112058798dup - AMOT(NM_001113490.1):c.1195_1196insAGC (p.(Gln398dup)) - AMOT_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.15G>A - r.(=) p.(=) g.112058736C>T - Q5Q - AMOT_000020 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - 4/208 cases - 0 - Lucy Raymond
+?/. 7 c.699G>C - r.spl? p.(Gln233His) g.112035060C>G g.112791832C>G NM_001113490.1:c.1926G>C - AMOT_000003 - PubMed: Bosch 2016, Journal: Bosch 2016 - - De novo - - - 0 - Danielle Bosch
?/. - c.726C>T - r.(=) p.(=) g.112033984G>A - N242N - AMOT_000019 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - Lucy Raymond
?/. - c.1121G>A VUS r.(?) p.(Arg374Gln) g.112024239C>T - AMOT(NM_001113490.1):c.2348G>A (p.R783Q) - AMOT_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1203C>A - r.(=) p.(=) g.112024157G>T - I401I - AMOT_000018 recurrent, found 18 times PubMed: Tarpey 2009 - - Germline - 18/208 cases - 0 - Lucy Raymond
?/. - c.1229G>A VUS r.(?) p.(Ser410Asn) g.112024131C>T - AMOT(NM_001113490.1):c.2456G>A (p.S819N) - AMOT_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1247-169C>T - - p.(=) g.112023077G>A g.112779849G>A - - AMOT_000002 - - - - Germline - - - - - Yu Sun
?/. - c.1261G>A - r.(?) p.(Gly421Arg) g.112022894C>T - - - AMOT_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - Lucy Raymond
?/. - c.1271G>A VUS r.(?) p.(Arg424His) g.112022884C>T - AMOT(NM_001113490.1):c.2498G>A (p.R833H) - AMOT_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1382C>T likely benign r.(?) p.(Thr461Met) g.112022773G>A - AMOT(NM_001113490.1):c.2609C>T (p.T870M) - AMOT_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1438G>A VUS r.(?) p.(Ala480Thr) g.112022717C>T - AMOT(NM_001113490.1):c.2665G>A (p.A889T) - AMOT_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1452_1466dup likely benign r.(?) p.(Ala485_Ala489dup) g.112022695_112022709dup - AMOT(NM_001113490.1):c.2693_2694insTGCCGCCATCACTGC (p.(Ala894_Ala898dup)) - AMOT_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.1511_1537del VUS r.(?) p.(Val504_Pro512del) g.112022631_112022657del - AMOT(NM_001113490.1):c.2738_2764del (p.(Val913_Pro921del)) - AMOT_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.1511_1537del - r.(?) p.(Val504_Pro512del) g.112022618_112022644del - 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - Lucy Raymond
?/. - c.1568C>T VUS r.(?) p.(Ala523Val) g.112022587G>A - AMOT(NM_001113490.1):c.2795C>T (p.A932V) - AMOT_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1576A>G - r.(?) p.(Thr526Ala) g.112022579T>C - - - AMOT_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - Lucy Raymond
?/. - c.1625C>T VUS r.(?) p.(Ala542Val) g.112022530G>A - AMOT(NM_001113490.1):c.2852C>T (p.A951V, p.(Ala951Val)) - AMOT_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.1625C>T likely benign r.(?) p.(Ala542Val) g.112022530G>A - AMOT(NM_001113490.1):c.2852C>T (p.A951V, p.(Ala951Val)) - AMOT_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1706_1723del likely benign r.(?) p.(Pro569_Ala574del) g.112022442_112022459del - AMOT(NM_001113490.1):c.2933_2950del (p.(Pro978_Ala983del)) - AMOT_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1817C>T likely benign r.(?) p.(Ala606Val) g.112022338G>A - AMOT(NM_001113490.1):c.3044C>T (p.A1015V) - AMOT_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1855_1857dup - r.(?) p.(Pro619dup) g.112022298_112022300dup - 1857_1858insCCT;K619_A620insP - AMOT_000015 recurrent, found 5 times PubMed: Tarpey 2009 - - Germline - 5/208 cases - 0 - Lucy Raymond