Unique variants in the AMOT gene

Information The variants shown are described using the NM_133265.2 transcript reference sequence.

27 entries on 1 page. Showing entries 1 - 27.
Legend   How to query  




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







?/. 1 - c.? r.(?) p.(Arg534Lys) - VUS g.? - - - USP9X_000005 - PubMed: Heidet 2017 - - Germline - - - - - Johan den Dunnen
?/. 1 - c.-356+7257_-356+7258del r.(=) p.(=) - VUS g.112068284_112068285del g.112825056_112825057del - - AMOT_000001 - - - - Germline - - - - - Yu Sun
-?/. 1 - c.-355-6814C>G r.(=) p.(=) - likely benign g.112065919G>C g.112822691G>C AMOT(NM_001113490.1):c.436C>G (p.R146G) - AMOT_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.-347A>C r.(?) p.(=) - VUS g.112059097T>G g.112815869T>G AMOT(NM_001113490.1):c.881A>C (p.(Gln294Pro)) - AMOT_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.-173C>T r.(?) p.(=) - likely benign g.112058923G>A - AMOT(NM_001113490.1):c.1055C>T (p.P352L) - AMOT_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.-125G>A r.(?) p.(=) - likely benign g.112058875C>T g.112815647C>T AMOT(NM_001113490.1):c.1103G>A (p.(Arg368His)), AMOT(NM_001113490.2):c.1103G>A (p.R368H) - AMOT_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen
?/. 1 - c.-35_-33dup r.(?) p.(=) - VUS g.112058796_112058798dup g.112815568_112815570dup AMOT(NM_001113490.1):c.1195_1196insAGC (p.(Gln398dup)) - AMOT_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.15G>A r.(=) p.(=) - VUS g.112058736C>T g.112815508C>T Q5Q - AMOT_000020 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - 4/208 cases - - - Lucy Raymond
+?/. 1 7 c.699G>C r.spl? p.(Gln233His) - likely pathogenic g.112035060C>G g.112791832C>G NM_001113490.1:c.1926G>C - AMOT_000003 - PubMed: Bosch 2016, Journal: Bosch 2016 - - De novo - - - - - Danielle Bosch
?/. 1 - c.726C>T r.(=) p.(=) - VUS g.112033984G>A g.112790756G>A N242N - AMOT_000019 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - - - Lucy Raymond
?/. 1 - c.1121G>A r.(?) p.(Arg374Gln) - VUS g.112024239C>T g.112781011C>T AMOT(NM_001113490.1):c.2348G>A (p.R783Q) - AMOT_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1203C>A r.(=) p.(=) - VUS g.112024157G>T g.112780929G>T I401I - AMOT_000018 recurrent, found 18 times PubMed: Tarpey 2009 - - Germline - 18/208 cases - - - Lucy Raymond
?/. 1 - c.1229G>A r.(?) p.(Ser410Asn) - VUS g.112024131C>T g.112780903C>T AMOT(NM_001113490.1):c.2456G>A (p.S819N) - AMOT_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1247-169C>T r.(=) p.(=) - VUS g.112023077G>A g.112779849G>A - - AMOT_000002 - - - - Germline - - - - - Yu Sun
?/. 1 - c.1261G>A r.(?) p.(Gly421Arg) - VUS g.112022894C>T g.112779666C>T - - AMOT_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - - - Lucy Raymond
?/. 1 - c.1271G>A r.(?) p.(Arg424His) - VUS g.112022884C>T g.112779656C>T AMOT(NM_001113490.1):c.2498G>A (p.R833H) - AMOT_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1382C>T r.(?) p.(Thr461Met) - likely benign g.112022773G>A g.112779545G>A AMOT(NM_001113490.1):c.2609C>T (p.T870M) - AMOT_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1438G>A r.(?) p.(Ala480Thr) - VUS g.112022717C>T g.112779489C>T AMOT(NM_001113490.1):c.2665G>A (p.A889T) - AMOT_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1452_1466dup r.(?) p.(Ala485_Ala489dup) - likely benign g.112022695_112022709dup g.112779467_112779481dup AMOT(NM_001113490.1):c.2693_2694insTGCCGCCATCACTGC (p.(Ala894_Ala898dup)) - AMOT_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.1511_1537del r.(?) p.(Val504_Pro512del) - VUS g.112022631_112022657del g.112779403_112779429del 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A, 1 more item - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators, 1 more item PubMed: Tarpey 2009 - - CLASSIFICATION record, Germline - 2/208 cases - - - Lucy Raymond, VKGL-NL_Leiden
?/. 1 - c.1568C>T r.(?) p.(Ala523Val) - VUS g.112022587G>A g.112779359G>A AMOT(NM_001113490.1):c.2795C>T (p.A932V) - AMOT_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1576A>G r.(?) p.(Thr526Ala) - VUS g.112022579T>C g.112779351T>C - - AMOT_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - - - Lucy Raymond
-?/., ?/. 2 - c.1625C>T r.(?) p.(Ala542Val) - likely benign, VUS g.112022530G>A g.112779302G>A AMOT(NM_001113490.1):c.2852C>T (p.A951V, p.(Ala951Val)) - AMOT_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.1706_1723del r.(?) p.(Pro569_Ala574del) - likely benign g.112022442_112022459del g.112779214_112779231del AMOT(NM_001113490.1):c.2933_2950del (p.(Pro978_Ala983del)) - AMOT_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.1817C>T r.(?) p.(Ala606Val) - likely benign g.112022338G>A g.112779110G>A AMOT(NM_001113490.1):c.3044C>T (p.A1015V) - AMOT_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1855_1857dup r.(?) p.(Pro619dup) - VUS g.112022299_112022301dup g.112779071_112779073dup 1857_1858insCCT;K619_A620insP - AMOT_000015 recurrent, found 5 times PubMed: Tarpey 2009 - - Germline - 5/208 cases - - - Lucy Raymond
-?/. 1 - c.1872C>T r.(?) p.(Thr624=) - likely benign g.112022283G>A - AMOT(NM_001113490.1):c.3099C>T (p.T1033=) - AMOT_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query