All variants in the AMOT gene

Information The variants shown are described using the NM_133265.2 transcript reference sequence.

2 entries on 1 page. Showing entries 1 - 2.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.1511_1537del r.(?) p.(Val504_Pro512del) - VUS g.112022631_112022657del g.112779403_112779429del AMOT(NM_001113490.1):c.2738_2764del (p.(Val913_Pro921del)) - AMOT_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.1511_1537del r.(?) p.(Val504_Pro512del) - VUS g.112022631_112022657del g.112779403_112779429del 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - Lucy Raymond
Legend   How to query