Unique variants in the ARID1A gene

Information The variants shown are described using the NM_006015.4 transcript reference sequence.

173 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
./. 1 - c.-140_*83349dup r.? p.? - pathogenic g.27022755_27190596dup g.26696264_26864105dup - - ARID1A_000099 increased gene dosage PubMed: DDDS 2015, Journal: DDDS 2015 - - De novo - - - - - Johan den Dunnen
?/? 1 - c.-27C>T r.(=) p.(=) - VUS g.27022868C>T g.26696377C>T - - ARID1A_000097 - - - - Unknown - - - - - Gijs Santen
+/. 1 1 c.19_53del r.(?) p.(Pro7Alafs* 92) ACMG pathogenic (dominant) g.27022913_27022947del g.26696422_26696456del - - ARID1A_000176 - PubMed: Squeo 2020 - - De novo - - - - - Johan den Dunnen
+/., ?/+? 2 1 c.31_56del r.(?) p.(Ser11Alafs*91) - pathogenic, VUS g.27022925_27022950del g.26696434_26696459del - - ARID1A_000085 - PubMed: Tsurusaki 2012, PubMed: Tsurusaki 2014 - - Germline, Unknown - - - - - Global Variome, with Curator vacancy, Eline van der Sluijs
-/., -?/., ?/. 3 - c.126_128dup r.(?) p.(Ala45dup) - benign, likely benign, VUS g.27023020_27023022dup g.26696529_26696531dup ARID1A(NM_006015.4):c.113_114insGGC (p.(Ala45dup)), ARID1A(NM_006015.4):c.126_128dupGGC (p.A45dup) - ARID1A_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen
?/. 1 - c.287C>T r.(?) p.(Ala96Val) - VUS g.27023181C>T g.26696690C>T ARID1A(NM_006015.4):c.287C>T (p.(Ala96Val)) - ARID1A_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/? 1 1 c.289G>T r.(?) p.(Glu97*) - VUS g.27023183G>T g.26696692G>T Chr1.hg18:g.26895770G>T - ARID1A_000057 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/. 1 - c.401C>T r.(?) p.(Ala134Val) - VUS g.27023295C>T g.26696804C>T - - ARID1A_000132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.448T>C r.(?) p.(Phe150Leu) - VUS g.27023342T>C g.26696851T>C ARID1A(NM_006015.4):c.448T>C (p.F150L) - ARID1A_000139 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.463G>A r.(?) p.(Gly155Ser) - VUS g.27023357G>A - ARID1A(NM_006015.4):c.463G>A (p.G155S) - ARID1A_000179 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.465C>T r.(?) p.(Gly155=) - VUS g.27023359C>T g.26696868C>T ARID1A(NM_006015.4):c.465C>T (p.G155=) - ARID1A_000140 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.472C>T r.(?) p.(Pro158Ser) - VUS g.27023366C>T g.26696875C>T ARID1A(NM_006015.4):c.472C>T (p.(Pro158Ser)) - ARID1A_000107 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/? 2 1 c.486_492del r.(?) p.(Ala163Argfs*67) - VUS g.27023380_27023386del g.26696889_26696895del Chr1.hg18:g.26895967_26895973delCGCCGCC - ARID1A_000069 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 1 c.553C>T r.(?) p.(Gln185*) - VUS g.27023447C>T g.26696956C>T Chr1.hg18:g.26896034C>T - ARID1A_000072 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
-?/. 1 - c.581C>T r.(?) p.(Pro194Leu) - likely benign g.27023475C>T g.26696984C>T ARID1A(NM_006015.4):c.581C>T (p.(Pro194Leu)) - ARID1A_000108 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/? 1 1 c.585C>A r.(?) p.(Tyr195*) - VUS g.27023479C>A g.26696988C>A Chr1.hg18:g.26896066C>A - ARID1A_000073 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 1 c.608dup r.(?) p.(His203Glnfs*197) - VUS g.27023502dup g.26697011dup Chr1.hg18:g.26896089dupA - ARID1A_000074 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
+/. 1 - c.636C>G r.(?) p.(Tyr212Ter) - pathogenic g.27023530C>G g.26697039C>G ARID1A(NM_006015.4):c.636C>G (p.Y212*) - ARID1A_000141 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 2 - c.735_737dup r.(?) p.(Ala247dup) - likely benign, VUS g.27023629_27023631dup g.26697138_26697140dup ARID1A(NM_006015.4):c.726_727insGCG (p.(Ala247dup)), ARID1A(NM_006015.4):c.735_737dupGGC (p.A247dup) - ARID1A_000143 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen
?/? 1 1 c.782_791del r.(?) p.(Ser261Cysfs*99) - VUS g.27023676_27023685del g.26697185_26697194del Chr1.hg18:g.26896263_26896272delCGTCGTCTTC - ARID1A_000081 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 1 c.827del r.(?) p.(Gly276Glufs*87) - VUS g.27023721del g.26697230del - - ARID1A_000020 - - - - Somatic - - - - - Sian Jones
?/? 1 1 c.854del r.(?) p.(Gly285Glufs*78) - VUS g.27023748del g.26697257del - - ARID1A_000027 - - - - Somatic - - - - - Sian Jones
?/? 1 1 c.879dup r.(?) p.(Thr294Hisfs*106) - VUS g.27023773dup g.26697282dup - - ARID1A_000019 - - - - Somatic - - - - - Sian Jones
?/? 1 1 c.883dup r.(?) p.(Leu295Profs*105) - VUS g.27023777dup g.26697286dup Chr1.hg18:g.26896364dupC - ARID1A_000082 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 1 c.899_902dup r.(?) p.(Pro302Valfs*99) - VUS g.27023793_27023796dup g.26697302_26697305dup Chr1.hg18:g.26896379_2689637980_insCGTC - ARID1A_000083 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 1 c.903_904dup r.(?) p.(Pro302Argfs*62) - VUS g.27023797_27023798dup g.26697306_26697307dup Chr1.hg18:g.26978879-26978880dupGT - ARID1A_000084 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 1 c.971_977del r.(?) p.(Gly324Alafs*37) - VUS g.27023865_27023871del g.26697374_26697380del 969_975delGGGCGCC - ARID1A_000028 - - - - Somatic - - - - - Sian Jones
?/? 2 1 c.1015del r.(?) p.(Ala339Leufs*24) - VUS g.27023909del g.26697418del - - ARID1A_000005, ARID1A_000031 - - - - Somatic - - - - - Sian Jones
?/. 1 - c.1029_1043del r.(?) p.(Ala345_Ala349del) - VUS g.27023923_27023937del g.26697432_26697446del ARID1A(NM_006015.4):c.1015_1029del (p.(Ala344_Ala348del)) - ARID1A_000109 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/., ?/? 2 1 c.1113del r.(?) p.(Gln372Serfs*19) - pathogenic, VUS g.27024007del g.26697516del - - ARID1A_000098 - PubMed: Santen 2013 - - De novo, Unknown yes - - - - Gijs Santen, Eline van der Sluijs
+/. 1 2 c.1165A>T r.(?) p.(Lys389*) - pathogenic (dominant) g.27056169A>T g.26729678A>T - - ARID1A_000136 - PubMed: Martinez 2017, Journal: Martinez 2017 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.1217del r.(?) p.(Gly406AspfsTer27) - pathogenic g.27056221del g.26729730del ARID1A(NM_006015.4):c.1217delG (p.G406Dfs*27) - ARID1A_000160 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1220C>G r.(?) p.(Pro407Arg) - VUS g.27056224C>G - ARID1A(NM_006015.4):c.1220C>G (p.P407R) - ARID1A_000180 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.1244A>G r.(?) p.(His415Arg) - VUS g.27056248A>G - ARID1A(NM_006015.4):c.1244A>G (p.H415R) - ARID1A_000181 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 2 c.1323del r.(?) p.(Met442Trpfs*177) - VUS g.27056327del g.26729836del - - ARID1A_000001 - - - - Somatic - - - - - Sian Jones
?/? 1 2 c.1341T>G r.(?) p.(Tyr447*) - VUS g.27056345T>G g.26729854T>G Chr1.hg18:g.26928932T>G - ARID1A_000045 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 8 - c.1351-22A>C r.(=) p.(=) - VUS g.27057621A>C g.26731130A>C - - ARID1A_000088 - - - - Unknown - - - - - Gijs Santen
?/? 1 3 c.1451_1455dup r.(?) p.(Ser486Profs*135) - VUS g.27057743_27057747dup g.26731252_26731256dup Chr1.hg18:g.26930334_26930335insCCTAC - ARID1A_000046 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 3 c.1585C>T r.(?) p.(Gln529*) - VUS g.27057877C>T g.26731386C>T - - ARID1A_000041 - - - - Somatic - - - - - Sian Jones
?/? 1 3 c.1626_1627del r.(?) p.(Gln543Alafs*79) - VUS g.27057918_27057919del g.26731427_26731428del Chr1.hg18:g.26930505_26930506delGC - ARID1A_000047 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 3 c.1650dup r.(?) p.(Tyr551Leufs*72) - VUS g.27057942dup g.26731451dup Chr1.hg18:g.26930529dupC - ARID1A_000048 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 3 c.1657C>T r.(?) p.(Gln553*) - VUS g.27057949C>T g.26731458C>T - - ARID1A_000014 - - - - Somatic - - - - - Sian Jones
?/? 1 3 c.1663C>T r.(?) p.(Gln555*) - VUS g.27057955C>T g.26731464C>T Chr1.hg18:g.26930542C>T - ARID1A_000049 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
-?/. 1 - c.1734G>A r.(?) p.(Ala578=) - likely benign g.27058026G>A g.26731535G>A ARID1A(NM_006015.4):c.1734G>A (p.A578=) - ARID1A_000165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.1791C>T r.(?) p.(Phe597=) - likely benign g.27058083C>T - ARID1A(NM_006015.4):c.1791C>T (p.F597=) - ARID1A_000186 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1803+3A>T r.spl? p.? - VUS g.27058098A>T g.26731607A>T - - ARID1A_000133 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/? 1 - c.1804-37T>C r.(=) p.(=) - VUS g.27059130T>C g.26732639T>C - - ARID1A_000089 - - - - Unknown - - - - - Gijs Santen
?/? 1 4 c.1804G>T r.(spl?) p.(Glu602*) - VUS g.27059167G>T g.26732676G>T Chr1.hg18:g.26931754G>T - ARID1A_000050 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 4 c.1848del r.(?) p.(Ser617Glnfs*2) - VUS g.27059211del g.26732720del - - ARID1A_000012 - - - - Somatic - - - - - Sian Jones
?/? 1 4 c.1873C>T r.(?) p.(Gln625*) - VUS g.27059236C>T g.26732745C>T Chr1.hg18:g.26931823C>T - ARID1A_000051 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 4 c.1881del r.(?) p.(Asp627Glufs*2) - VUS g.27059244del g.26732753del Chr1.hg18:g.26931831delT - ARID1A_000052 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 5 c.1946dup r.(?) p.(Met651Hisfs*25) - VUS g.27087372dup g.26760881dup - - ARID1A_000037 - - - - Somatic - - - - - Sian Jones
?/? 1 5 c.2122C>T r.(?) p.(Gln708*) - VUS g.27087548C>T g.26761057C>T Chr1.hg18:g.26960135C>T - ARID1A_000053 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
-/., ?/. 2 - c.2123A>C r.(?) p.(Gln708Pro) - benign, VUS g.27087549A>C g.26761058A>C ARID1A(NM_006015.4):c.2123A>C (p.Q708P, p.(Gln708Pro)) - ARID1A_000110 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
?/? 1 6 c.2179_2188del r.(?) p.(Arg727Valfs*12) - VUS g.27087892_27087901del g.26761401_26761410del Chr1.hg18:g.26960479_26960488delCGGCCACCCA - ARID1A_000054 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/. 1 - c.2180G>T r.(?) p.(Arg727Leu) - VUS g.27087893G>T g.26761402G>T ARID1A(NM_006015.4):c.2180G>T (p.R727L) - ARID1A_000166 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2198C>T r.(?) p.(Ser733Leu) - VUS g.27087911C>T - ARID1A(NM_006015.4):c.2198C>T (p.S733L) - ARID1A_000187 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.2204G>A r.(?) p.(Ser735Asn) - likely benign g.27087917G>A - ARID1A(NM_006015.4):c.2204G>A (p.S735N) - ARID1A_000182 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.2251+7G>C r.(=) p.(=) - likely benign g.27087971G>C - ARID1A(NM_006015.4):c.2251+7G>C - ARID1A_000188 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 7 c.2272del r.(?) p.(Gln758Argfs*75) - VUS g.27088663del g.26762172del Chr1.hg18:g.269611250delC - ARID1A_000055 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 7 c.2296dup r.(?) p.(Gln766Profs*51) - VUS g.27088687dup g.26762196dup - - ARID1A_000038 - - - - Somatic - - - - - Sian Jones
?/? 1 7 c.2357dup r.(?) p.(Ser787Leufs*30) - VUS g.27088748dup g.26762257dup - - ARID1A_000026 - - - - Somatic - - - - - Sian Jones
?/. 1 - c.2359_2360delinsAA r.(?) p.(Ser787Asn) - VUS g.27088750_27088751delinsAA - 2359T>A;2360C>A - ARID1A_000185 - - - - Germline - - - - - Andreas Laner
+/. 1 - c.2387del r.(?) p.(Tyr796Leufs*37) - pathogenic g.27088778del - ARID1A(NM_006015.4):c.2387delA (p.Y796Lfs*37) - ARID1A_000189 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/? 1 7 c.2402del r.(?) p.(Gly801Valfs*32) - VUS g.27088793del g.26762302del - - ARID1A_000042 - - - - Somatic - - - - - Sian Jones
?/? 7 - c.2420-18G>C r.(=) p.(=) - VUS g.27089446G>C g.26762955G>C - - ARID1A_000090 - - - - Unknown - - - - - Gijs Santen
+?/. 1 - c.2427C>A r.(?) p.(Tyr809*) ACMG pathogenic g.27089471C>A - - - ARID1A_000170 - - - - Somatic - 0.103 - - - Vanessa Mendonça
?/? 1 8 c.2467_2468dup r.(?) p.(Pro824Thrfs*10) - VUS g.27089511_27089512dup g.26763020_26763021dup 2467_2468dupTA - ARID1A_000018 - - - - Somatic - - - - - Sian Jones
-/. 1 - c.2541C>A r.(?) p.(Ile847=) - benign g.27089585C>A g.26763094C>A ARID1A(NM_006015.4):c.2541C>A (p.I847=) - ARID1A_000144 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.2590G>A r.(?) p.(Gly864Ser) - VUS g.27089634G>A g.26763143G>A ARID1A(NM_006015.4):c.2590G>A (p.(Gly864Ser)) - ARID1A_000111 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
./. 1 - c.2698G>A r.(?) p.(Ala900Thr) - pathogenic g.27089742G>A g.26763251G>A - - ARID1A_000100 - PubMed: DDDS 2015, Journal: DDDS 2015 - - Germline - - - - - Johan den Dunnen
-?/. 1 - c.2725C>G r.(?) p.(Gln909Glu) - likely benign g.27089769C>G g.26763278C>G ARID1A(NM_006015.4):c.2725C>G (p.Q909E) - ARID1A_000145 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., ?/+? 2 9 c.2758C>T r.(?) p.(Gln920*) - pathogenic, VUS g.27092737C>T g.26766246C>T - - ARID1A_000086 - PubMed: Tsurusaki 2012, PubMed: Tsurusaki 2014 - - Germline, Unknown - - - - - Global Variome, with Curator vacancy, Eline van der Sluijs
?/? 1 9 c.2830C>T r.(?) p.(Gln944*) - VUS g.27092809C>T g.26766318C>T - - ARID1A_000004 - - - - Somatic - - - - - Sian Jones
?/? 1 9 c.2834del r.(?) p.(Gly945Aspfs*23) - VUS g.27092813del g.26766322del - - ARID1A_000029 - - - - Somatic - - - - - Sian Jones
?/? 1 9 c.2868del r.(?) p.(Asn956Lysfs*12) - VUS g.27092847del g.26766356del Chr1.hg18:g.26965434delC - ARID1A_000056 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/. 2 - c.2870A>G r.(?) p.(Asn957Ser) - VUS g.27092849A>G g.26766358A>G ARID1A(NM_006015.4):c.2870A>G (p.N957S) - ARID1A_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/. 1 - c.2879-2A>G r.spl? p.? - pathogenic g.27092946A>G g.26766455A>G - - ARID1A_000161 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.2893C>G r.(?) p.(Pro965Ala) - likely benign g.27092962C>G g.26766471C>G ARID1A(NM_006015.4):c.2893C>G (p.(Pro965Ala)) - ARID1A_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/? 1 10 c.2949_2951del r.(?) p.(Asn983del) - VUS g.27093018_27093020del g.26766527_26766529del 2944_2946delAAC - ARID1A_000013 - - - - Somatic - - - - - Sian Jones
?/? 1 10i c.2988+1G>A r.spl? p.? - VUS g.27093058G>A g.26766567G>A IVS10+1G>A - ARID1A_000036 - - - - Somatic - - - - - Sian Jones
+/. 1 - c.3059G>A r.(?) p.(Arg1020Lys) - pathogenic g.27094351G>A g.26767860G>A ARID1A(NM_006015.4):c.3059G>A (p.R1020K) - ARID1A_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.3060dup r.(?) p.(Lys1021GlufsTer12) - pathogenic g.27094352dup g.26767861dup ARID1A(NM_006015.4):c.3060dupG (p.K1021Efs*12) - ARID1A_000167 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.3151C>T r.(?) p.(Leu1051Phe) - VUS g.27094443C>T g.26767952C>T - - ARID1A_000134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.3158G>A r.(?) p.(Arg1053His) - VUS g.27094450G>A g.26767959G>A - - ARID1A_000135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.3204C>G r.(?) p.(Asn1068Lys) - likely pathogenic g.27097615C>G - ARID1A(NM_006015.4):c.3204C>G (p.N1068K) - ARID1A_000190 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+?/. 1 - c.3218G>A r.(?) p.(Trp1073*) ACMG pathogenic g.27097629G>A - - - ARID1A_000171 - - - - Somatic - 0.059 - - - Vanessa Mendonça
?/? 1 12 c.3223del r.(?) p.(Glu1075Asnfs*18) - VUS g.27097634del g.26771143del Chr1.hg18:g.26970221delG - ARID1A_000058 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 12 c.3281del r.(?) p.(Lys1094Serfs*67) - VUS g.27097692del g.26771201del - - ARID1A_000007 - - - - Somatic - - - - - Sian Jones
?/? 1 12 c.3344del r.(?) p.(Pro1115Glnfs*46) - VUS g.27097755del g.26771264del - - ARID1A_000008 - - - - Somatic - - - - - Sian Jones
?/? 1 12 c.3391del r.(?) p.(Gln1131Serfs*30) - VUS g.27097802del g.26771311del Chr1.hg18:g.26970389delC - ARID1A_000059 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
-?/. 1 - c.3407-8G>C r.(=) p.(=) - likely benign g.27098983G>C g.26772492G>C ARID1A(NM_006015.4):c.3407-8G>C - ARID1A_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? 1 13 c.3442del r.(?) p.(Gln1148Serfs*13) - VUS g.27099026del g.26772535del Chr1.hg18:g.26971613delC - ARID1A_000060 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
+?/. 1 - c.3539+1G>A r.spl? p.? ACMG pathogenic g.27099124G>A - - - ARID1A_000172 - - - - Somatic - 0.044 - - - Vanessa Mendonça
?/? 1 14 c.3575del r.(?) p.(Asn1192Metfs*14) - VUS g.27099338del g.26772847del Chr1.hg18:g.26971925delA - ARID1A_000061 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 1 14 c.3634_3644del r.(?) p.(Gln1212Glufs*4) - VUS g.27099397_27099407del g.26772906_26772916del Chr1.hg18:g.26971984_26971994delCAGCCCAGTAT - ARID1A_000062 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
?/? 2 14 c.3659_3684del r.(?) p.(Met1220Lysfs*2) - VUS g.27099422_27099447del g.26772931_26772956del Chr1.hg18:g.26972009_26972034delTGATGGGGCGCATGTCCTATGAGCCA - ARID1A_000063 - PubMed: Jones 2010 - - Somatic - - - - - Sian Jones
+/., ?/? 2 14 c.3679G>T r.(?) p.(Glu1227*) - pathogenic, VUS g.27099442G>T g.26772951G>T - - ARID1A_000091 - PubMed: Santen 2013 - - De novo yes - - - - Gijs Santen, Eline van der Sluijs
-?/. 2 - c.3702C>T r.(?) p.(Gly1234=) - likely benign g.27099465C>T g.26772974C>T ARID1A(NM_006015.4):c.3702C>T (p.G1234=) - ARID1A_000115 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
-?/. 2 - c.3716-7C>T r.(=) p.(=) - likely benign g.27099830C>T g.26773339C>T ARID1A(NM_006015.4):c.3716-7C>T (, p.(=)) - ARID1A_000116 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
Legend   How to query   « First ‹ Prev     1 2     Next › Last »