All variants in the ARID1B gene

Information The variants shown are described using the NM_020732.3 transcript reference sequence.

499 entries on 5 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.? r.(?) p.? - VUS g.? - Microdeletion, not specified - LAMA2_000000 - PubMed: Tsurusaki Y 2014 - - Unknown - - - 0 - Julia Lopez
?/. - c.? r.(?) p.? - VUS g.? - Deletion of ARID1B, not specified - LAMA2_000000 - PubMed: Santen GW 2013 - - Unknown - - - 0 - Julia Lopez
+/. - c.? r.? p.? - pathogenic (recessive) g.? - - - LAMA2_000000 - PubMed: Sanchis-Juan 2018 - - De novo - - - 0 - Johan den Dunnen
?/? - c.-444599_*5881702del r.0? p.0? - VUS g.156654465_163410727del - - - PARK2_000136 - - - - Unknown - - - 0 - Gijs Santen
+/. 1 c.-1880_1542+177del r.? p.? ACMG pathogenic (dominant) g.157097179-157100787del - - - ARID1B_000357 - - - - De novo - - - - - Wenjuan Qiu
+/. _1_20_ c.(?_-1)_(*8_?)del r.0 p.0 - pathogenic (dominant) g.(156740000_157099063)_(157529026_157890000)del - - - ARID1B_000090 probably de novo ~790 kb deletion 6q25.3 PubMed: Homan 2014 - - De novo - - - 0 - Johan den Dunnen
+/. _1_20_ c.-1_*2888{0} r.0 p.0 - pathogenic (dominant) g.(?_156960439)_(158889653_?)del - - arr 6q25.3(156960439_158889653)x1 ARID1B_000093 - PubMed: Wieczorek 2013 - - De novo - - - 0 - Johan den Dunnen
?/. _1_1i c.(?_1)_(1542+1_1543-1)dup r.(=) p.(=) - VUS g.(?_157099064)_(157100606_157150360)dup - 1_1542dup - ARID1B_000091 - - - - De novo - - - 0 - Eline van der Sluijs
+/+ _1_20_ c.(?_1)_(*2888_?)del r.0 p.0 - pathogenic (dominant) g.(?_157140756)_(157573605_?)del - - - ARID1B_000004 - PubMed: Santen et al 2012 - - De novo - - - 0 - Gijs Santen
+/+ _1_20_ c.(?_1)_(*2888_?)del r.0 p.0 - pathogenic (dominant) g.(?_157140756)_(157573605_?)del - - - ARID1B_000004 - PubMed: Santen et al 2012 - - De novo - - - 0 - Gijs Santen
+/? _1_20_ c.(?_1)_(*2888_?)del r.0 p.0 - pathogenic (dominant) g.(?_157140756)_(157573605_?)del - - - ARID1B_000004 - PubMed: Santen et al 2012 - - De novo - - - 0 - Gijs Santen
+/+ _1_20_ c.(?_1)_(*2888_?)del r.0 p.0 - pathogenic (dominant) g.(?_157140756)_(157573605_?)del - - - ARID1B_000004 - PubMed: Hoyer et al 2012 - - De novo - - - 0 - Global Variome, with Curator vacancy
+/. 1 c.64_74del r.(?) p.(Glu22Glnfs*206) - VUS g.157099127_157099137del g.156777993_156778003del 64_74delGAGGCGGCTCT - ARID1B_000121 - - - - Germline/De novo (untested) - - - 0 - IMGAG
?/. - c.76A>C r.(?) p.(Lys26Gln) - VUS g.157099139A>C - ARID1B(NM_001346813.1):c.76A>C (p.K26Q) - ARID1B_000362 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.81G>T r.(?) p.(Glu27Asp) - VUS g.157099144G>T - ARID1B(NM_001346813.1):c.81G>T (p.E27D) - ARID1B_000342 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.121_123del r.(?) p.(Ser41del) - benign g.157099184_157099186del g.156778050_156778052del ARID1B(NM_001371656.1):c.370_372delTCC (p.S124del) - ARID1B_000220 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.121_123dup r.(?) p.(Ser41dup) - likely benign g.157099184_157099186dup g.156778050_156778052dup ARID1B(NM_020732.3):c.121_123dupTCC (p.S41dup) - ARID1B_000221 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.133_141del r.(?) p.(Ala45_Ala47del) - benign g.157099196_157099204del - ARID1B(NM_001346813.1):c.133_141delGCGGCGGCA (p.A45_A47del), ARID1B(NM_020732.3):c.133_141delGCGGCGGCA (p.A45_A47del) - ARID1B_000328 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.133_141del r.(?) p.(Ala45_Ala47del) - benign g.157099196_157099204del - ARID1B(NM_001371656.1):c.382_390delGCGGCGGCA (p.A128_A130del) - ARID1B_000328 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.197A>G r.(?) p.(Asn66Ser) - likely benign g.157099260A>G g.156778126A>G ARID1B(NM_017519.2):c.197A>G (p.(Asn66Ser)) - ARID1B_000222 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.357_362dup r.(?) p.(Gln130_Gln131dup) - benign g.157099420_157099425dup g.156778286_156778291dup ARID1B(NM_001371656.1):c.606_611dupGCAGCA (p.Q213_Q214dup) - ARID1B_000311 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.357_362dup r.(?) p.(Gln130_Gln131dup) - benign g.157099420_157099425dup - ARID1B(NM_001371656.1):c.606_611dupGCAGCA (p.Q213_Q214dup) - ARID1B_000311 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.360_362dup r.(?) p.(Gln131dup) - likely benign g.157099423_157099425dup g.156778289_156778291dup ARID1B(NM_001371656.1):c.609_611dupGCA (p.Q214dup) - ARID1B_000227 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.362_363insGC r.(?) p.(Gln122HisfsTer59) - likely benign g.157099425_157099426insGC g.156778291_156778292insGC ARID1B(NM_001371656.1):c.611_612insGC (p.Q205Hfs*59) - ARID1B_000296 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.363_371del r.(?) p.(Gln129_Gln131del) - likely benign g.157099426_157099434del g.156778292_156778300del ARID1B(NM_020732.3):c.363_371delACAGCAGCA (p.Q129_Q131del) - ARID1B_000127 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.369_392del r.(?) p.(Gln124_Gln131del) - likely benign g.157099432_157099455del g.156778298_156778321del ARID1B(NM_017519.2):c.340_363del (p.(Gln124_Gln131del)) - ARID1B_000297 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.369_392dup r.(?) p.(Gln124_Gln131dup) - likely benign g.157099432_157099455dup - ARID1B(NM_001346813.1):c.369_392dupGCAGCAGCAGCAGCAGCAACAGCA (p.Q124_Q131dup) - ARID1B_000125 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.372_373insGAG r.(?) p.(Gln124_Gln125insGlu) - likely benign g.157099435_157099436insGAG g.156778301_156778302insGAG ARID1B(NM_017519.2):c.370_371insAGG (p.(Gln124_Gln125insGlu)) - ARID1B_000298 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.381_386dup r.(?) p.(Gln130_Gln131dup) - VUS g.157099444_157099449dup g.156778310_156778315dup ARID1B(NM_001371656.1):c.630_635dupGCAGCA (p.Q213_Q214dup), ARID1B(NM_017519.2):c.363_364insCAGCAG (p.(Gln120_Gln121dup)) - ARID1B_000128 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.381_386dup r.(?) p.(Gln130_Gln131dup) - benign g.157099444_157099449dup g.156778310_156778315dup ARID1B(NM_001371656.1):c.630_635dupGCAGCA (p.Q213_Q214dup), ARID1B(NM_017519.2):c.363_364insCAGCAG (p.(Gln120_Gln121dup)) - ARID1B_000128 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.383_384insACA r.(?) p.(Gln131dup) - likely benign g.157099446_157099447insACA g.156778312_156778313insACA ARID1B(NM_017519.2):c.381_382insCAA (p.(Gln131dup)) - ARID1B_000299 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.395A>G r.(?) p.(His132Arg) - likely benign g.157099458A>G - ARID1B(NM_001346813.1):c.395A>G (p.H132R) - ARID1B_000343 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.430_441del r.(?) p.(Gly144_Ala147del) - likely benign g.157099493_157099504del - ARID1B(NM_001346813.1):c.430_441delGGCGGCGGCGCG (p.G144_A147del), ARID1B(NM_001371656.1):c.679_690delGGCGGCGGCGCG (p.G227_A230del) - ARID1B_000329 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.430_441del r.(?) p.(Gly144_Ala147del) - VUS g.157099493_157099504del - ARID1B(NM_001346813.1):c.430_441delGGCGGCGGCGCG (p.G144_A147del), ARID1B(NM_001371656.1):c.679_690delGGCGGCGGCGCG (p.G227_A230del) - ARID1B_000329 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.616G>A r.(?) p.(Gly206Ser) - likely benign g.157099679G>A g.156778545G>A ARID1B(NM_001371656.1):c.865G>A (p.G289S) - ARID1B_000130 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
?/. - c.652C>G r.(?) p.(Pro218Ala) - VUS g.157099715C>G g.156778581C>G ARID1B(NM_020732.3):c.652C>G (p.P218A) - ARID1B_000131 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.705C>T r.(?) p.(Gly235=) - likely benign g.157099768C>T - ARID1B(NM_001346813.1):c.705C>T (p.G235=) - ARID1B_000363 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? - c.714C>T r.(=) p.(=) - VUS g.157099777C>T g.156778643C>T - - ARID1B_000034 - - - - Unknown - - - - - Gijs Santen
-?/. - c.714C>T r.(?) p.(Ala238=) - likely benign g.157099777C>T g.156778643C>T ARID1B(NM_001346813.1):c.714C>T (p.A238=) - ARID1B_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.719C>G r.(?) p.(Ala240Gly) - likely benign g.157099782C>G g.156778648C>G ARID1B(NM_020732.3):c.719C>G (p.A240G) - ARID1B_000300 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.736G>A r.(?) p.(Gly246Ser) - likely benign g.157099799G>A g.156778665G>A ARID1B(NM_017519.2):c.736G>A (p.(Gly246Ser)), ARID1B(NM_020732.3):c.736G>A (p.G246S) - ARID1B_000132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.736G>A r.(?) p.(Gly246Ser) - likely benign g.157099799G>A g.156778665G>A ARID1B(NM_017519.2):c.736G>A (p.(Gly246Ser)), ARID1B(NM_020732.3):c.736G>A (p.G246S) - ARID1B_000132 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.808T>G r.(?) p.(Ser270Ala) - likely benign g.157099871T>G - ARID1B(NM_001346813.1):c.808T>G (p.S270A) - ARID1B_000364 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.808_816del r.(?) p.(Ser270_Ala272del) - VUS g.157099871_157099879del - ARID1B(NM_001346813.1):c.808_816delTCCGCCGCC (p.S270_A272del) - ARID1B_000344 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.928G>T r.(?) p.(Gly310Cys) - VUS g.157099991G>T - ARID1B(NM_001346813.1):c.928G>T (p.G310C) - ARID1B_000345 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.936_944del r.(?) p.(Gly317_Gly319del) - likely benign g.157099999_157100007del - ARID1B(NM_001371656.1):c.1185_1193delCGGCGGCGG (p.G400_G402del) - ARID1B_000137 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.939_944dup r.(?) p.(Gly318_Gly319dup) - likely benign g.157100002_157100007dup - ARID1B(NM_001371656.1):c.1188_1193dupCGGCGG (p.G401_G402dup), ARID1B(NM_017519.2):c.918_919insGGCGGC (p.(Ala306_Gly307insGlyGly)) - ARID1B_000321 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.939_944dup r.(?) p.(Gly318_Gly319dup) - likely benign g.157100002_157100007dup - ARID1B(NM_001371656.1):c.1188_1193dupCGGCGG (p.G401_G402dup), ARID1B(NM_017519.2):c.918_919insGGCGGC (p.(Ala306_Gly307insGlyGly)) - ARID1B_000321 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.942_944dup r.(?) p.(Gly319dup) - likely benign g.157100005_157100007dup g.156778871_156778873dup ARID1B(NM_001346813.1):c.942_944dupCGG (p.G319dup) - ARID1B_000136 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.945A>C r.(?) p.(Gly315=) - benign g.157100008A>C g.156778874A>C ARID1B(NM_020732.3):c.945A>C (p.G315=) - ARID1B_000188 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
-?/. - c.945A>C r.(?) p.(Gly315=) - likely benign g.157100008A>C g.156778874A>C ARID1B(NM_020732.3):c.945A>C (p.G315=) - ARID1B_000188 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.954_956del r.(?) p.(Gly319del) - likely benign g.157100017_157100019del g.156778883_156778885del ARID1B(NM_001371656.1):c.1203_1205delAGG (p.G402del), ARID1B(NM_017519.2):c.943_945del (p.(Gly315del)) - ARID1B_000138 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.954_956del r.(?) p.(Gly319del) - benign g.157100017_157100019del g.156778883_156778885del ARID1B(NM_001371656.1):c.1203_1205delAGG (p.G402del), ARID1B(NM_017519.2):c.943_945del (p.(Gly315del)) - ARID1B_000138 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+?/. - c.957_958insGGCGGAGGAGGACGAGGC r.(?) p.(Gly319_Ser320insGlyGlyGlyGlyArgGly) - likely pathogenic g.157100020_157100021insGGCGGAGGAGGACGAGGC g.156778886_156778887insGGCGGAGGAGGACGAGGC ARID1B(NM_020732.3):c.952_953insGAGGCGGCGGAGGAGGAC (p.(Gly318_Gly319insGlyGlyGlyGlyGlyArg)) - ARID1B_000139 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.957_983del r.(?) p.(Ser320_Gly328del) - VUS g.157100020_157100046del g.156778886_156778912del - - ARID1B_000233 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.977_985dup r.(?) p.(Gly326_Gly328dup) - likely benign g.157100040_157100048dup - ARID1B(NM_001346813.1):c.977_985dupGAGGAGGAG (p.G326_G328dup) - ARID1B_000346 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.980_985dup r.(?) p.(Gly327_Gly328dup) - VUS g.157100043_157100048dup - ARID1B(NM_001371656.1):c.1229_1234dupGAGGAG (p.G410_G411dup) - ARID1B_000330 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.983_985del r.(?) p.(Gly328del) - likely benign g.157100046_157100048del g.156778912_156778914del ARID1B(NM_001371656.1):c.1232_1234delGAG (p.G411del), ARID1B(NM_017519.2):c.961_963del (p.(Gly321del)) - ARID1B_000236 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - c.983_985del r.(?) p.(Gly328del) - benign g.157100046_157100048del g.156778912_156778914del ARID1B(NM_001371656.1):c.1232_1234delGAG (p.G411del), ARID1B(NM_017519.2):c.961_963del (p.(Gly321del)) - ARID1B_000236 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.983_985dup r.(?) p.(Gly328dup) - likely benign g.157100046_157100048dup g.156778912_156778914dup ARID1B(NM_017519.2):c.960_961insGGA (p.(Ser320_Gly321insGly)) - ARID1B_000140 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/? - c.998_1006dup r.(?) p.(Gly333_Gly335dup) - VUS g.157100061_157100069dup g.156778927_156778935dup - - ARID1B_000051 - - - - Unknown - - - - - Gijs Santen
?/? - c.998_1006dup r.(?) p.(Gly333_Gly335dup) - VUS g.157100061_157100069dup g.156778927_156778935dup - - ARID1B_000051 - - - - Unknown - - - - - Gijs Santen
-?/. - c.1016_1021dup r.(?) p.(Val339_Ala340dup) - likely benign g.157100079_157100084dup g.156778945_156778950dup ARID1B(NM_001346813.1):c.1016_1021dupTGGCGG (p.V339_A340dup), ARID1B(NM_001371656.1):c.1265_1270dupTGGCGG (p.V422_A423dup) - ARID1B_000312 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.1016_1021dup r.(?) p.(Val339_Ala340dup) - likely benign g.157100079_157100084dup - ARID1B(NM_001346813.1):c.1016_1021dupTGGCGG (p.V339_A340dup), ARID1B(NM_001371656.1):c.1265_1270dupTGGCGG (p.V422_A423dup) - ARID1B_000312 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.1029_1040del r.(?) p.(Ala347_Ala350del) - benign g.157100092_157100103del g.156778958_156778969del ARID1B(NM_020732.3):c.1029_1040delCGCGGCGGCGGC (p.A347_A350del) - ARID1B_000141 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1031C>T r.(?) p.(Ala344Val) - likely benign g.157100094C>T g.156778960C>T ARID1B(NM_020732.3):c.1031C>T (p.A344V) - ARID1B_000142 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-?/. - c.1041G>A r.(?) p.(Ala347=) - likely benign g.157100104G>A g.156778970G>A ARID1B(NM_020732.3):c.1041G>A (p.A347=) - ARID1B_000144 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
-/. - c.1041_1043del r.(?) p.(Ala350del) - benign g.157100104_157100106del g.156778970_156778972del ARID1B(NM_001346813.1):c.1041_1043delGGC (p.A350del) - ARID1B_000313 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
+?/. 1 c.1044_1062del r.(?) p.(Gly351Alafs*12) ACMG likely pathogenic (dominant) g.157100107_157100125del - - - ARID1B_000339 ACMG: PVS1, PM2: class 4; ClinVar (accessed Nov. 6, 2020) - ClinVar-000817019 - De novo - - - 0 - Andreas Laner
+?/. - c.1044_1068dup r.(?) p.(Gly357SerfsTer186) - likely pathogenic g.157100107_157100131dup g.156778973_156778997dup ARID1B(NM_020732.3):c.1029_1030insGCGGCGGCGGCGGCAGCAGCAGGAG (p.(Gly357SerfsTer186)) - ARID1B_000301 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.1049_1051dup r.(?) p.(Ala350dup) - VUS g.157100112_157100114dup g.156778978_156778980dup ARID1B(NM_001371656.1):c.1298_1300dupCAG (p.A433dup), ARID1B(NM_017519.2):c.1041_1042insGCA (p.(Ala347dup)) - ARID1B_000145 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-?/. - c.1049_1051dup r.(?) p.(Ala350dup) - likely benign g.157100112_157100114dup - ARID1B(NM_001371656.1):c.1298_1300dupCAG (p.A433dup), ARID1B(NM_017519.2):c.1041_1042insGCA (p.(Ala347dup)) - ARID1B_000145 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.1069_1071del r.(?) p.(Gly357del) - likely benign g.157100132_157100134del g.156778998_156779000del ARID1B(NM_001346813.1):c.1069_1071delGGC (p.G357del), ARID1B(NM_017519.2):c.1054_1056del (p.(Gly357del)) - ARID1B_000241 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1069_1071del r.(?) p.(Gly357del) - likely benign g.157100132_157100134del g.156778998_156779000del ARID1B(NM_001346813.1):c.1069_1071delGGC (p.G357del), ARID1B(NM_017519.2):c.1054_1056del (p.(Gly357del)) - ARID1B_000241 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1069_1071dup r.(?) p.(Gly357dup) - VUS g.157100132_157100134dup g.156778998_156779000dup ARID1B(NM_017519.2):c.1053_1054insGGC (p.(Gly351dup)) - ARID1B_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.1088C>T r.(?) p.(Ala363Val) - VUS g.157100151C>T g.156779017C>T ARID1B(NM_017519.2):c.1088C>T (p.(Ala363Val)) - ARID1B_000147 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
+/+ 1 c.1114dup r.(?) p.(Arg372Profs*163) - pathogenic (dominant) g.157100177dup g.156779043dup - - ARID1B_000016 - PubMed: Hoyer et al 2012 - - De novo - - - 0 - Global Variome, with Curator vacancy
+/. - c.1146dup r.(?) p.(Gly383ArgfsTer152) - pathogenic g.157100209dup - ARID1B(NM_020732.3):c.1146dupC (p.G383Rfs*152) - ARID1B_000242 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - c.1187G>C r.(?) p.(Gly396Ala) - likely benign g.157100250G>C g.156779116G>C ARID1B(NM_017519.2):c.1187G>C (p.(Gly396Ala)), ARID1B(NM_020732.3):c.1187G>C (p.G396A) - ARID1B_000148 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
?/. - c.1187G>C r.(?) p.(Gly396Ala) - VUS g.157100250G>C g.156779116G>C ARID1B(NM_017519.2):c.1187G>C (p.(Gly396Ala)), ARID1B(NM_020732.3):c.1187G>C (p.G396A) - ARID1B_000148 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
+/. - c.1202del r.(?) p.(Gly401AlafsTer29) - pathogenic g.157100265del g.156779131del ARID1B(NM_020732.3):c.1202delG (p.G401Afs*29) - ARID1B_000149 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
+/. 1 c.1202dup r.(?) p.(Phe402Leufs* 133) ACMG pathogenic (dominant) g.157100265dup g.156779131dup - - ARID1B_000333 - PubMed: Squeo 2020 - - De novo - - - 0 - Johan den Dunnen
?/? - c.1222dup r.(?) p.(Gln408Profs*127) - VUS g.157100285dup g.156779151dup - - ARID1B_000052 - - - - De novo - - - - - Gijs Santen
?/. 1 c.1222dup r.(?) p.(Gly410Argfs*152) - VUS g.157100285dup g.156779151dup p.(Gln408Profs*127) - ARID1B_000052 - PubMed: Santen GW 2013 - - De novo - - - 0 - Julia Lopez
?/? - c.1235dup r.(?) p.(Ser413Valfs*122) - VUS g.157100298dup g.156779164dup - - ARID1B_000019 - - - - De novo - - - - - Gijs Santen
?/. 1 c.1235dup r.(?) p.(Gly413Argfs*149) - VUS g.157100298dup g.156779164dup specified - ARID1B_000019 - PubMed: Santen GW 2013 - - De novo - - - 0 - Julia Lopez
+/. 1 c.1259del r.(?) p.(Asn420Ilefs*10) - pathogenic (dominant) g.157100322del g.156779188del - - ARID1B_000104 Affected mother, passed the mutation on to her son. - - - De novo yes - - - - Eline van der Sluijs
+/. 1 c.1259del r.(?) p.(Asn420Ilefs*10) - pathogenic (dominant) g.157100322del g.156779188del - - ARID1B_000104 - - - - Germline yes - - 0 - Eline van der Sluijs
?/? - c.1259dup r.(?) p.(Asn420Lysfs*115) - VUS g.157100322dup g.156779188dup - - ARID1B_000020 - - - - De novo - - - - - Gijs Santen
?/. 1 c.1259dup r.(?) p.(Ala421Glyfs*141) - VUS g.157100322dup g.156779188dup p.(Asn420Lysfs*115) - ARID1B_000020 - PubMed: Santen GW 2013 - - De novo - - - 0 - Julia Lopez
-?/. - c.1285A>G r.(?) p.(Met429Val) - likely benign g.157100348A>G g.156779214A>G ARID1B(NM_001346813.1):c.1285A>G (p.M429V), ARID1B(NM_001371656.1):c.1534A>G (p.M512V) - ARID1B_000150 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Groningen
-?/. - c.1285A>G r.(?) p.(Met429Val) - likely benign g.157100348A>G g.156779214A>G ARID1B(NM_001346813.1):c.1285A>G (p.M429V), ARID1B(NM_001371656.1):c.1534A>G (p.M512V) - ARID1B_000150 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1320C>G r.(?) p.(Tyr440Ter) - pathogenic g.157100383C>G g.156779249C>G - - ARID1B_000189 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Nijmegen
?/. - c.1345_1350del r.(?) p.(Pro449_Pro450del) - VUS g.157100408_157100413del - ARID1B(NM_001371656.1):c.1594_1599delCCGCCG (p.P532_P533del) - ARID1B_000365 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.1345_1350dup r.(?) p.(Pro449_Pro450dup) - VUS g.157100408_157100413dup - ARID1B(NM_001346813.1):c.1345_1350dupCCGCCG (p.P449_P450dup) - ARID1B_000347 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/? - c.1346del r.(?) p.(Pro449Argfs*53) - VUS g.157100409del g.156779275del - - ARID1B_000021 - - - - De novo - - - - - Gijs Santen
?/. 1 c.1346del r.(?) p.(Leu449Argfs*8) - VUS g.157100409del g.156779275del p.(Pro449Argfs*53) - ARID1B_000021 - PubMed: Santen GW 2013 - - De novo - - - 0 - Julia Lopez
?/. - c.1348_1350dup r.(?) p.(Pro450dup) - VUS g.157100411_157100413dup g.156779277_156779279dup ARID1B(NM_001371656.1):c.1597_1599dupCCG (p.P533dup), ARID1B(NM_017519.2):c.1333_1334insCGC (p.(Pro450dup)) - ARID1B_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
-/. - c.1348_1350dup r.(?) p.(Pro450dup) - benign g.157100411_157100413dup g.156779277_156779279dup ARID1B(NM_001371656.1):c.1597_1599dupCCG (p.P533dup), ARID1B(NM_017519.2):c.1333_1334insCGC (p.(Pro450dup)) - ARID1B_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.1373_1381del r.(?) p.(Ala458_Ala460del) - VUS g.157100436_157100444del - ARID1B(NM_001346813.1):c.1373_1381delCGGCGGCGG (p.A458_A460del) - ARID1B_000322 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query   « First ‹ Prev     1 2 3 4 5     Next › Last »