All variants in the ARSD gene

Information The variants shown are described using the NM_001669.3 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 5 c.701_730del r.(?) p.(Ala234_Trp244delinsGly) - VUS g.2835978_2836007del g.2917937_2917966del c.701_730delCCGGCGTGGGCTGCCTGTTTTTCATCTCTT - ARSD_000014 recurrent, found 6 times PubMed: Tarpey 2009 - - Germline - 6/208 cases - 0 - Lucy Raymond
Legend   How to query