All variants in the CHKB-CPT1B gene

Information The variants shown are described using the NR_027928.2 transcript reference sequence.

47 entries on 1 page. Showing entries 1 - 47.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. - n.-645358_*3824346del r.0? p.0? - pathogenic g.47182944_51666786del - - - ALG12_000022 mosaicism, hemizygous in 0.56 cells PubMed: DDDS 2015, Journal: DDDS 2015 - - Somatic - - - - - Johan den Dunnen
-?/. - n.256C>T r.(?) - - likely benign g.51021173G>A - CHKB(NM_005198.4):c.38C>T (p.A13V) - CHKB_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - n.282G>A r.(?) - - likely benign g.51021147C>T g.50582718C>T - - CHKB_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - n.367A>G r.(?) - - likely benign g.51021062T>C - CHKB(NM_005198.4):c.149A>G (p.(Tyr50Cys)) - CHKB_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - n.432T>C r.(?) - - likely benign g.51020997A>G g.50582568A>G - - CHKB_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - n.467C>T r.(?) - - likely benign g.51020762G>A g.50582333G>A CHKB(NM_005198.4):c.249C>T (p.F83=) - CHKB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - n.467C>T r.(?) - - likely benign g.51020762G>A - CHKB(NM_005198.4):c.249C>T (p.F83=) - CHKB_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - n.481C>T r.(?) - - VUS g.51020748G>A - CHKB(NM_005198.4):c.263C>T (p.P88L) - CHKB_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - n.551+6G>A r.(?) - - likely benign g.51020672C>T g.50582243C>T CHKB(NM_005198.4):c.333+6G>A - CHKB_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - n.551+10G>T r.(?) - - benign g.51020668C>A g.50582239C>A CHKB(NM_005198.5):c.333+10G>T, CHKB-CPT1B(NR_027928.2):n.551+10G>T - CHKB_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - n.637del r.(?) - - pathogenic g.51020208del - CHKB(NM_005198.4):c.419delC (p.P140Qfs*14) - CHKB_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - n.637del r.(?) - - pathogenic g.51020208del - CHKB(NM_005198.4):c.419delC (p.P140Qfs*14) - CHKB_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - n.657T>G r.(?) - - VUS g.51020186A>C g.50581757A>C CHKB(NM_005198.5):c.439T>G (p.Y147D) - CHKB_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - n.675T>C r.(?) - - likely benign g.51019973A>G g.50581544A>G CHKB(NM_005198.4):c.457T>C (p.L153=) - CHKB_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. - n.693C>T r.(?) - - likely pathogenic g.51019955G>A - CHKB(NM_005198.5):c.475C>T (p.R159*) - CHKB_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. - n.719T>G r.(?) - - likely benign g.51019929A>C g.50581500A>C CHKB(NM_005198.5):c.501T>G (p.I167M) - CHKB_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - n.888A>C r.(?) - - likely benign g.51019001T>G g.50580572T>G CHKB(NM_005198.4):c.670A>C (p.(Asn224His), p.N224H) - CHKB_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - n.888A>C r.(?) - - likely benign g.51019001T>G - CHKB(NM_005198.4):c.670A>C (p.(Asn224His), p.N224H) - CHKB_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - n.926C>T r.(?) - - likely benign g.51018815G>A - CHKB(NM_005198.5):c.708C>T (p.(Val236=)) - CHKB_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - n.940A>G r.(?) - - VUS g.51018801T>C - - - CHKB_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - n.1006_1008del r.(?) - - VUS g.51018650_51018652del - CHKB(NM_005198.5):c.788_790delTGG (p.V263del) - CHKB_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - n.1035del r.(?) - - pathogenic g.51018620del g.50580191del - - CHKB_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - n.1108A>C r.(?) - - VUS g.51018440T>G - CHKB(NM_005198.5):c.890A>C (p.(Lys297Thr)) - CHKB_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - n.1120C>T r.(?) - - likely benign g.51018428G>A g.50579999G>A CHKB(NM_005198.5):c.902C>T (p.T301I) - CHKB_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - n.1198C>T r.(?) - - likely benign g.51018207G>A g.50579778G>A - - CHKB_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - n.1201A>G r.(?) - - likely benign g.51018204T>C g.50579775T>C CHKB(NM_005198.4):c.983A>G (p.Q328R) - CHKB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - n.1201A>G r.(?) - - likely benign g.51018204T>C - CHKB(NM_005198.4):c.983A>G (p.Q328R) - CHKB_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - n.1226A>T r.(?) - - likely benign g.51018179T>A g.50579750T>A CHKB(NM_005198.4):c.1008A>T (p.E336D) - CHKB_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+?/. - n.1249G>A r.(?) - - likely pathogenic g.51018156C>T - CHKB(NM_005198.5):c.1031G>A (p.R344Q) - CHKB_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - n.1249+3G>C r.(?) - - VUS g.51018153C>G g.50579724C>G CHKB(NM_005198.4):c.1031+3G>C (p.?) - CHKB_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. - n.1332-11_1351del r.(?) - - likely pathogenic g.51017669_51017699del - CHKB(NM_005198.5):c.1114-11_1133delTCCTTCCCTAGGACTATGCCCAGTCTCGGTT - CHKB_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. - n.1502G>C r.(?) - - VUS g.51017514C>G g.50579085C>G - - CHKB_000021 - - - - Germline - - - - - Yu Sun
-/. - n.1555C>T r.(?) - - benign g.51016360G>A g.50577931G>A - - CHKB_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.1852-18C>T r.(?) - - benign g.51015481G>A g.50577052G>A - - CHKB_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.2456-6C>T r.(?) - - benign g.51012854G>A g.50574425G>A CPT1B(NM_152245.3):c.886-6C>T - CHKB_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - n.2456-6C>T r.(?) - - benign g.51012854G>A g.50574425G>A CPT1B(NM_152245.3):c.886-6C>T - CHKB_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.2736+12T>C r.(?) - - benign g.51011937A>G g.50573508A>G - - CPT1B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.2736+13A>G r.(?) - - benign g.51011936T>C g.50573507T>C - - CPT1B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.2736+16A>G r.(?) - - benign g.51011933T>C g.50573504T>C - - CPT1B_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.2850C>G r.(?) - - benign g.51011376G>C g.50572947G>C - - CPT1B_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.2878C>T r.(?) - - benign g.51011348G>A g.50572919G>A - - CPT1B_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - n.3145+19G>A r.(?) - - benign g.51010416C>T g.50571987C>T - - CPT1B_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - n.3154G>A r.(?) - - VUS g.51009960C>T - CPT1B(NM_152246.3):c.1584G>A (p.(Ala528=)) - CHKB-CPT1B_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. - n.3161G>A r.(?) - - benign g.51009953C>T - - - CHKB-CPT1B_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - n.3441-15A>G r.(?) - - likely benign g.51009487T>C g.50571058T>C CPT1B(NM_152245.3):c.1876-15A>G - CHKB-CPT1B_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - n.3441-15A>G r.(?) - - benign g.51009487T>C g.50571058T>C CPT1B(NM_152245.3):c.1876-15A>G - CHKB-CPT1B_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - n.3454G>A r.(?) - - likely benign g.51009459C>T - CPT1B(NM_152245.2):c.1889G>A (p.R630Q) - CHKB-CPT1B_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (interacting with LOVD using scripts to download data) is strictly prohibited.
Use our APIs to retrieve data.