Unique variants in the CST3 gene

Mutations in Hereditary Amyloidosis; consortium homepage
Information The variants shown are described using the NM_000099.2 transcript reference sequence.

12 entries on 1 page. Showing entries 1 - 12.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.40A>G r.(?) p.(Ile14Val) - likely benign g.23618460T>C - CST3(NM_000099.2):c.40A>G (p.(Ile14Val)) - CST3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.73G>A r.(?) p.(Ala25Thr) - benign g.23618427C>T g.23637790C>T CST3(NM_001288614.2):c.73G>A (p.A25T) - CST3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.105= r.(=) p.(Leu35=) - benign g.23618395T>C g.23637758T>C CST3(NM_000099.4):c.105A>G (p.L35=) - CST3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. 1 - c.200T>G r.(?) p.(Met67Arg) - likely benign g.23618300A>C - CST3(NM_000099.2):c.200T>G (p.(Met67Arg)) - CST3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.214G>T r.(?) p.(Ala72Ser) - likely benign g.23618286C>A - CST3(NM_000099.2):c.214G>T (p.(Ala72Ser)) - CST3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.235C>A r.(?) p.(Arg79Ser) - likely benign g.23618265G>T g.23637628G>T CST3(NM_000099.2):c.235C>A (p.(Arg79Ser)) - CST3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.243+2T>A r.spl? p.? - VUS g.23618255A>T - CST3(NM_001288614.1):c.243+2T>A - CST3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.260A>C r.(?) p.(Asn87Thr) - VUS g.23615988T>G - CST3(NM_000099.2):c.260A>C (p.(Asn87Thr)) - CST3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.277_296del r.(?) p.(Glu93Tyrfs*14) - VUS g.23615957_23615976del - CST3(NM_000099.4):c.277_296delGAGCTGGGCCGAACCACGTG (p.E93Yfs*14) - CST3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 2 c.281T>A r.281u>a p.Leu94Gln - pathogenic g.23615967A>T g.23635330A>T AluI-, Leu68Gln - CST3_000001 first 10 aminoacids are missing from cystatin C protein isolated from the patients’ amyloid PubMed: Palsdottir 1988, Journal: Palsdottir 1988, OMIM:var0001 - rs28939068 Germline yes - AluI- - - Johan den Dunnen
+?/. 1 - c.360del r.(?) p.(Ala121HisfsTer16) - likely pathogenic g.23614636del g.23633999del CST3(NM_001288614.2):c.360delA (p.A121Hfs*16) - CST3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.424A>G r.(?) p.(Thr142Ala) - likely benign g.23614570T>C - CST3(NM_000099.2):c.424A>G (p.(Thr142Ala)) - CST3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.