All variants in the DLC1 gene

Information The variants shown are described using the NM_182643.2 transcript reference sequence.

33 entries on 1 page. Showing entries 1 - 33.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. - c.-53394A>G r.(?) p.(=) - likely benign g.13425379T>C g.13567870T>C C8orf48(NM_001007090.3):c.879T>C (p.C293=) - DLC1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.-52862T>G r.(?) p.(=) - likely benign g.13424847A>C g.13567338A>C C8orf48(NM_001007090.3):c.347A>C (p.D116A) - DLC1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.167A>G r.(?) p.(Glu56Gly) - likely benign g.13357414T>C - DLC1(NM_182643.2):c.167A>G (p.E56G) - DLC1_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.250G>A r.(?) p.(Asp84Asn) - benign g.13357331C>T - DLC1(NM_182643.3):c.250G>A (p.D84N) - DLC1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.721C>G r.(?) p.(Pro241Ala) - likely benign g.13356860G>C - DLC1(NM_182643.2):c.721C>G (p.P241A) - DLC1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.750C>T r.(?) p.(Cys250=) - likely benign g.13356831G>A - DLC1(NM_182643.3):c.750C>T (p.C250=) - DLC1_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.800T>C r.(?) p.(Leu267Pro) - likely benign g.13356781A>G - DLC1(NM_182643.2):c.800T>C (p.L267P) - DLC1_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.926A>T r.(?) p.(Lys309Met) - likely benign g.13356655T>A - DLC1(NM_182643.3):c.926A>T (p.K309M) - DLC1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1033G>A r.(?) p.(Glu345Lys) - likely benign g.13259119C>T g.13401610C>T DLC1(NM_024767.3):c.1033G>A (p.(Glu345Lys)) - DLC1_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.1049C>T r.(?) p.(Ala350Val) - likely benign g.13259103G>A g.13401594G>A DLC1(NM_182643.2):c.1049C>T (p.A350V) - DLC1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1052G>A r.(?) p.(Arg351Gln) - likely benign g.13259100C>T - DLC1(NM_182643.3):c.1052G>A (p.R351Q) - DLC1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1162C>T r.(?) p.(Arg388Trp) - likely benign g.13258990G>A - DLC1(NM_182643.3):c.1162C>T (p.R388W) - DLC1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1314+15A>G r.(=) p.(=) - likely benign g.13251047T>C - DLC1(NM_182643.3):c.1314+15A>G - DLC1_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1315-28900C>G r.(=) p.(=) - VUS g.13191711G>C g.13334202G>C - - DLC1_000001 - - - - Germline - - - - - Yu Sun
-?/. - c.1315-16G>C r.(=) p.(=) - likely benign g.13162827C>G - DLC1(NM_182643.3):c.1315-16G>C - DLC1_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1362G>A r.(?) p.(Lys454=) - likely benign g.12973153C>T - DLC1(NM_182643.3):c.1362G>A (p.K454=) - DLC1_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1920G>C r.(?) p.(Leu640=) - likely benign g.12957926C>G - DLC1(NM_182643.2):c.1920G>C (p.L640=) - DLC1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2189G>A r.(?) p.(Arg730Gln) - likely benign g.12957657C>T - DLC1(NM_182643.3):c.2189G>A (p.R730Q) - DLC1_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.2199C>T r.(?) p.(Ser733=) - likely benign g.12957647G>A - DLC1(NM_182643.3):c.2199C>T (p.S733=) - DLC1_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.2414C>T r.(?) p.(Thr805Met) - likely benign g.12957432G>A - DLC1(NM_182643.2):c.2414C>T (p.T805M) - DLC1_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2471A>G r.(?) p.(Asn824Ser) - likely benign g.12957375T>C g.13099866T>C DLC1(NM_182643.2):c.2471A>G (p.N824S) - DLC1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2927_2947dup r.(?) p.(Glu982_Arg983insLysProSerGluIleProGlu) - VUS g.12956899_12956919dup g.13099390_13099410dup DLC1(NM_182643.3):c.2927_2947dupAGCCCTCCGAGATCCCGGAAA (p.E982_R983ins7) - DLC1_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.2990+13C>T r.(=) p.(=) - likely benign g.12956843G>A - DLC1(NM_182643.3):c.2990+13C>T - DLC1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.2990+20C>T r.(=) p.(=) - likely benign g.12956836G>A - DLC1(NM_182643.3):c.2990+20C>T - DLC1_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.3377G>A r.(?) p.(Arg1126His) - VUS g.12952417C>T - DLC1(NM_182643.2):c.3377G>A (p.R1126H) - DLC1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3551A>T r.(?) p.(Gln1184Leu) - likely benign g.12950310T>A - DLC1(NM_182643.3):c.3551A>T (p.Q1184L) - DLC1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.3856-6G>A r.(=) p.(=) - likely benign g.12947985C>T - DLC1(NM_182643.2):c.3856-6G>A, DLC1(NM_182643.3):c.3856-6G>A - DLC1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.3856-6G>A r.(=) p.(=) - likely benign g.12947985C>T - DLC1(NM_182643.2):c.3856-6G>A, DLC1(NM_182643.3):c.3856-6G>A - DLC1_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.4046C>G r.(?) p.(Ser1349Trp) - VUS g.12947789G>C g.13090280G>C DLC1(NM_182643.2):c.4046C>G (p.S1349W) - DLC1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.4046C>T r.(?) p.(Ser1349Leu) - likely benign g.12947789G>A g.13090280G>A DLC1(NM_182643.2):c.4046C>T (p.S1349L) - DLC1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.4062G>A r.(?) p.(=) - likely benign g.12947773C>T - DLC1(NM_182643.3):c.4062G>A (p.L1354=) - DLC1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.4292+1G>A r.spl? p.? - VUS g.12945995C>T g.13088486C>T DLC1(NM_182643.3):c.4292+1G>A - DLC1_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.4440C>T r.(?) p.(Leu1480=) - likely benign g.12943825G>A - DLC1(NM_182643.2):c.4440C>T (p.L1480=) - DLC1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.