All variants in the GDF5 gene

Information The variants shown are described using the NM_000557.2 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. - c.517_536dup r.(?) p.(Leu180CysfsTer20) - pathogenic g.34025175_34025194dup - GDF5(NM_000557.4):c.517_536dupATGCTCTCGCTGTACAGGAC (p.L180Cfs*20) - GDF5_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query