All transcript variants in gene HPS4

Information The variants shown are described using the NM_022081.5 transcript reference sequence.

1 entry on 1 page. Showing entry 1.



AscendingDNA change (cDNA)     


RNA change     


DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. - c.-806_-786del benign r.(?) p.(=) g.26879985_26880005del - SRRD(NM_001013694.2):c.129_149delGAGAGAGGCGGCGCCCCGGGG (p.R44_G50del) - SRRD_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL