All variants in the KCNC3 gene

Information The variants shown are described using the NM_004977.2 transcript reference sequence.

96 entries on 1 page. Showing entries 1 - 96.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. - c.24G>T r.(?) p.(Ser8=) - likely benign g.50832316C>A - KCNC3(NM_004977.2):c.24G>T (p.S8=) - KCNC3_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.34_55dup r.(?) p.(Gln19ArgfsTer89) - VUS g.50832287_50832308dup g.50329030_50329051dup KCNC3(NM_004977.2):c.34_55dupGGGCGCCAGGGGGCCAGCAAGC (p.Q19Rfs*89) - KCNC3_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.34_55dup r.(?) p.(Gln19ArgfsTer89) - VUS g.50832287_50832308dup - KCNC3(NM_004977.3):c.34_55dupGGGCGCCAGGGGGCCAGCAAGC (p.Q19Rfs*89) - KCNC3_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-/. - c.123G>T r.(?) p.(Gln41His) - benign g.50832217C>A g.50328960C>A KCNC3(NM_004977.3):c.123G>T (p.Q41H) - KCNC3_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.127C>T r.(?) p.(Pro43Ser) - likely benign g.50832213G>A - KCNC3(NM_004977.2):c.127C>T (p.P43S) - KCNC3_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.162C>T r.(?) p.(Gly54=) - likely benign g.50832178G>A g.50328921G>A KCNC3(NM_004977.3):c.162C>T (p.G54=) - KCNC3_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.188A>G r.(?) p.(Asp63Gly) - likely benign g.50832152T>C g.50328895T>C KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G) - KCNC3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.188A>G r.(?) p.(Asp63Gly) - benign g.50832152T>C g.50328895T>C KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G) - KCNC3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.188A>G r.(?) p.(Asp63Gly) - benign g.50832152T>C g.50328895T>C KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G) - KCNC3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.188A>G r.(?) p.(Asp63Gly) - likely benign g.50832152T>C g.50328895T>C KCNC3(NM_004977.2):c.188A>G (p.D63G), KCNC3(NM_004977.3):c.188A>G (p.D63G) - KCNC3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.315G>C r.(?) p.(Thr105=) - likely benign g.50832025C>G g.50328768C>G KCNC3(NM_004977.2):c.315G>C (p.T105=), KCNC3(NM_004977.3):c.315G>C (p.T105=) - KCNC3_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-?/. - c.315G>C r.(?) p.(Thr105=) - likely benign g.50832025C>G g.50328768C>G KCNC3(NM_004977.2):c.315G>C (p.T105=), KCNC3(NM_004977.3):c.315G>C (p.T105=) - KCNC3_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.579C>G r.(?) p.(Arg193=) - VUS g.50831761G>C g.50328504G>C KCNC3(NM_004977.3):c.579C>G (p.R193=) - KCNC3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.579C>T r.(?) p.(Arg193=) - VUS g.50831761G>A g.50328504G>A KCNC3(NM_004977.3):c.579C>T (p.R193=) - KCNC3_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.642_650dup r.(?) p.(Asn215_Ala217dup) - VUS g.50831705_50831713dup g.50328448_50328456dup KCNC3(NM_004977.2):c.642_650dupCAACGCCGC (p.N215_A217dup) - KCNC3_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.649G>A r.(?) p.(Ala217Thr) - benign g.50831691C>T g.50328434C>T KCNC3(NM_004977.2):c.649G>A (p.A217T) - KCNC3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.871-21C>G r.(=) p.(=) - benign g.50827360G>C g.50324103G>C KCNC3(NM_004977.3):c.871-21C>G - KCNC3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.984G>A r.(?) p.(Pro328=) - likely benign g.50827226C>T g.50323969C>T KCNC3(NM_004977.2):c.984G>A (p.P328=), KCNC3(NM_004977.3):c.984G>A (p.P328=) - KCNC3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.984G>A r.(?) p.(Pro328=) - benign g.50827226C>T g.50323969C>T KCNC3(NM_004977.2):c.984G>A (p.P328=), KCNC3(NM_004977.3):c.984G>A (p.P328=) - KCNC3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1002G>A r.(?) p.(Pro334=) - likely benign g.50827208C>T g.50323951C>T KCNC3(NM_004977.2):c.1002G>A (p.P334=) - KCNC3_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1032G>A r.(?) p.(Thr344=) - likely benign g.50827178C>T g.50323921C>T KCNC3(NM_004977.2):c.1032G>A (p.T344=) - KCNC3_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1032G>T r.(?) p.(Thr344=) - likely benign g.50827178C>A g.50323921C>A KCNC3(NM_004977.3):c.1032G>T (p.T344=) - KCNC3_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.1084G>A r.(?) p.(Glu362Lys) - VUS g.50827126C>T - KCNC3(NM_004977.2):c.1084G>A (p.E362K) - KCNC3_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1153G>A r.(?) p.(Asp385Asn) - VUS g.50827057C>T - - - KCNC3_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1215C>T r.(?) p.(Ala405=) - likely benign g.50826995G>A - KCNC3(NM_004977.2):c.1215C>T (p.A405=) - KCNC3_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1259G>A r.(?) p.(Arg420His) - pathogenic g.50826951C>T g.50323694C>T KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H) - KCNC3_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1259G>A r.(?) p.(Arg420His) - pathogenic g.50826951C>T g.50323694C>T KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H) - KCNC3_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.1259G>A r.(?) p.(Arg420His) - VUS g.50826951C>T g.50323694C>T KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H) - KCNC3_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.1259G>A r.(?) p.(Arg420His) - pathogenic g.50826951C>T g.50323694C>T KCNC3(NM_004977.2):c.1259G>A (p.R420H), KCNC3(NM_004977.3):c.1259G>A (p.R420H) - KCNC3_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+?/. 2 c.1268G>A r.(?) p.(Arg423His) - likely pathogenic g.50826942C>T g.50323685C>T - - KCNC3_000001 - PubMed: van de Warrenburg 2016, Journal: van de Warrenburg 2016 - - Germline - - - - - Erik-Jan Kamsteeg
+/. - c.1268G>A r.(?) p.(Arg423His) - pathogenic g.50826942C>T g.50323685C>T KCNC3(NM_004977.3):c.1268G>A (p.R423H) - KCNC3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/. - c.1268G>A r.(?) p.(Arg423His) - pathogenic g.50826942C>T g.50323685C>T KCNC3(NM_004977.3):c.1268G>A (p.R423H) - KCNC3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. - c.1268G>A r.(?) p.(Arg423His) - pathogenic g.50826942C>T g.50323685C>T KCNC3(NM_004977.3):c.1268G>A (p.R423H) - KCNC3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. - c.1268G>A r.(?) p.(Arg423His) - pathogenic g.50826942C>T g.50323685C>T KCNC3(NM_004977.3):c.1268G>A (p.R423H) - KCNC3_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
+/. - c.1268G>A r.(?) p.(Arg423His) ACMG pathogenic (dominant) g.50826942C>T g.50323685C>T - - KCNC3_000001 - PubMed: Helbig 2016 - - De novo - - - - - Johan den Dunnen
+/. - c.1268G>A r.spl? p.(Arg423His) ACMG pathogenic (dominant) g.50826942C>T g.50323685C>T - - KCNC3_000001 ACMG: PS3, PS4, PP3_MOD, PM2_SUP; variant inherited from unaffected father, father has this variant with a VAF of 22% PMID: 25356970, 23734863, 22289912, 19953606, 26795593, 21479265, 28216058, 28467418, 25756792, 33624863 - - Germline ? - - - - Andreas Laner
?/. - c.1286G>A r.(?) p.(Arg429Gln) - VUS g.50826924C>T g.50323667C>T - - KCNC3_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.1293C>T r.(?) p.(Phe431=) - likely benign g.50826917G>A - KCNC3(NM_004977.2):c.1293C>T (p.F431=) - KCNC3_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. - c.1342T>C r.(?) p.(Phe448Leu) - pathogenic g.50826868A>G g.50323611A>G - - KCNC3_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.1404C>T r.(?) p.(Tyr468=) - benign g.50826806G>A g.50323549G>A KCNC3(NM_004977.3):c.1404C>T (p.Y468=) - KCNC3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1405G>A r.(?) p.(Ala469Thr) - VUS g.50826805C>T g.50323548C>T KCNC3(NM_004977.3):c.1405G>A (p.A469T) - KCNC3_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. - c.1429G>A r.(?) p.(Asp477Asn) - VUS g.50826781C>T g.50323524C>T KCNC3(NM_004977.3):c.1429G>A (p.D477N) - KCNC3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1603G>A r.(?) p.(Val535Met) - VUS g.50826607C>T g.50323350C>T KCNC3(NM_004977.3):c.1603G>A (p.V535M) - KCNC3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1609G>A r.(?) p.(Val537Ile) - VUS g.50826601C>T g.50323344C>T - - KCNC3_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. - c.1641G>A r.(?) p.(Ser547=) - benign g.50826569C>T g.50323312C>T KCNC3(NM_004977.2):c.1641G>A (p.S547=), KCNC3(NM_004977.3):c.1641G>A (p.S547=) - KCNC3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1641G>A r.(?) p.(Ser547=) - likely benign g.50826569C>T g.50323312C>T KCNC3(NM_004977.2):c.1641G>A (p.S547=), KCNC3(NM_004977.3):c.1641G>A (p.S547=) - KCNC3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1696C>T r.(?) p.(Pro566Ser) - VUS g.50826514G>A g.50323257G>A KCNC3(NM_004977.2):c.1696C>T (p.(Pro566Ser)) - KCNC3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. - c.1706C>T r.(?) p.(Pro569Leu) - VUS g.50826504G>A g.50323247G>A - - KCNC3_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. - c.1719C>G r.(?) p.(Asn573Lys) - VUS g.50826491G>C g.50323234G>C KCNC3(NM_004977.2):c.1719C>G (p.N573K) - KCNC3_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1767C>T r.(?) p.(His589=) - likely benign g.50826443G>A - KCNC3(NM_004977.2):c.1767C>T (p.H589=) - KCNC3_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1771A>G r.(?) p.(Ser591Gly) - VUS g.50826439T>C g.50323182T>C KCNC3(NM_004977.2):c.1771A>G (p.S591G), KCNC3(NM_004977.3):c.1771A>G (p.S591G) - KCNC3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1771A>G r.(?) p.(Ser591Gly) - likely benign g.50826439T>C g.50323182T>C KCNC3(NM_004977.2):c.1771A>G (p.S591G), KCNC3(NM_004977.3):c.1771A>G (p.S591G) - KCNC3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1873_1874del r.(?) p.(Arg625Glyfs*30) - VUS g.50826336_50826337del - KCNC3(NM_004977.3):c.1873_1874delAG (p.R625Gfs*30) - KCNC3_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.1876G>T r.(?) p.(Gly626Trp) - VUS g.50826334C>A g.50323077C>A KCNC3(NM_004977.3):c.1876G>T (p.G626W) - KCNC3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1884G>A r.(?) p.(Ala628=) - likely benign g.50826326C>T g.50323069C>T KCNC3(NM_004977.2):c.1884G>A (p.A628=), KCNC3(NM_004977.3):c.1884G>A (p.A628=) - KCNC3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.1884G>A r.(?) p.(Ala628=) - likely benign g.50826326C>T g.50323069C>T KCNC3(NM_004977.2):c.1884G>A (p.A628=), KCNC3(NM_004977.3):c.1884G>A (p.A628=) - KCNC3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1927G>A r.(?) p.(Gly643Ser) - VUS g.50826283C>T g.50323026C>T KCNC3(NM_004977.3):c.1927G>A (p.G643S) - KCNC3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.1929C>T r.(?) p.(Gly643=) - benign g.50826281G>A g.50323024G>A KCNC3(NM_004977.2):c.1929C>T (p.G643=), KCNC3(NM_004977.3):c.1929C>T (p.G643=) - KCNC3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.1929C>T r.(?) p.(Gly643=) - benign g.50826281G>A g.50323024G>A KCNC3(NM_004977.2):c.1929C>T (p.G643=), KCNC3(NM_004977.3):c.1929C>T (p.G643=) - KCNC3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.1978+3G>A r.spl? p.? - likely benign g.50826229C>T - KCNC3(NM_004977.2):c.1978+3G>A - KCNC3_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.1978+22C>G r.(=) p.(=) - VUS g.50826210G>C g.50322953G>C KCNC3(NM_004977.3):c.1978+22C>G - KCNC3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.2012C>T r.(?) p.(Ala671Val) - VUS g.50824008G>A g.50320751G>A KCNC3(NM_004977.2):c.2012C>T (p.A671V) - KCNC3_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2013G>A r.(?) p.(Ala671=) - likely benign g.50824007C>T g.50320750C>T KCNC3(NM_004977.2):c.2013G>A (p.A671=) - KCNC3_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2061G>T r.(?) p.(Pro687=) - likely benign g.50823959C>A g.50320702C>A KCNC3(NM_004977.2):c.2061G>T (p.P687=) - KCNC3_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.2093G>A r.(?) p.(Arg698His) - likely benign g.50823927C>T g.50320670C>T KCNC3(NM_004977.2):c.2093G>A (p.R698H) - KCNC3_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2114G>A r.(?) p.(Arg705Gln) - VUS g.50823906C>T - KCNC3(NM_004977.3):c.2114G>A (p.R705Q) - KCNC3_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. - c.2170+14C>T r.(=) p.(=) - benign g.50823836G>A g.50320579G>A KCNC3(NM_004977.2):c.2170+14C>T, KCNC3(NM_004977.3):c.2170+14C>T - KCNC3_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.2170+14C>T r.(=) p.(=) - likely benign g.50823836G>A g.50320579G>A KCNC3(NM_004977.2):c.2170+14C>T, KCNC3(NM_004977.3):c.2170+14C>T - KCNC3_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2171-26T>C r.(=) p.(=) - VUS g.50823632A>G g.50320375A>G KCNC3(NM_004977.3):c.2171-26T>C - KCNC3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. - c.2236G>A r.(?) p.(Asp746Asn) - VUS g.50823541C>T g.50320284C>T KCNC3(NM_004977.2):c.2236G>A (p.D746N), KCNC3(NM_004977.3):c.2236G>A (p.D746N) - KCNC3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.2236G>A r.(?) p.(Asp746Asn) - likely benign g.50823541C>T g.50320284C>T KCNC3(NM_004977.2):c.2236G>A (p.D746N), KCNC3(NM_004977.3):c.2236G>A (p.D746N) - KCNC3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.2236G>A r.(?) p.(Asp746Asn) - VUS g.50823541C>T g.50320284C>T - - KCNC3_000003 - PubMed: Thomas 2022 - - De novo - - - - - Johan den Dunnen
?/. - c.2256G>A r.(?) p.(Ala752=) - VUS g.50823521C>T g.50320264C>T KCNC3(NM_004977.3):c.2256G>A (p.A752=) - KCNC3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. - c.*1352A>T r.(=) p.(=) - benign g.50818020T>A g.50314763T>A KCNC3(NR_110912.2):n.547A>T - MYH14_000152 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. - c.*6325_*6329del r.(=) p.(=) - likely benign g.50813043_50813047del g.50309786_50309790del MYH14(NM_001077186.1):c.6008_6012del (p.(Gln2003delinsProLeuProCysProGlnMetHis)), MYH14(NM_001145809.1):c.6107_6111delAGTGA (p.Q2036Pfs*9) - MYH14_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6325_*6329del r.(=) p.(=) - likely benign g.50813043_50813047del g.50309786_50309790del MYH14(NM_001077186.1):c.6008_6012del (p.(Gln2003delinsProLeuProCysProGlnMetHis)), MYH14(NM_001145809.1):c.6107_6111delAGTGA (p.Q2036Pfs*9) - MYH14_000151 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.*6335T>G r.(=) p.(=) - likely benign g.50813037A>C g.50309780A>C MYH14(NM_001145809.1):c.6101A>C (p.H2034P) - MYH14_000150 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6339C>G r.(=) p.(=) - likely benign g.50813033G>C g.50309776G>C MYH14(NM_001145809.1):c.6097G>C (p.A2033P) - MYH14_000149 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6339_*6340del r.(=) p.(=) - likely benign g.50813032_50813033del g.50309775_50309776del MYH14(NM_001077186.1):c.5997_5998del (p.(Ala2000ProfsTer13)), MYH14(NM_001145809.1):c.6096_6097delAG (p.A2033Pfs*13) - MYH14_000148 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6339_*6340del r.(=) p.(=) - likely benign g.50813032_50813033del g.50309775_50309776del MYH14(NM_001077186.1):c.5997_5998del (p.(Ala2000ProfsTer13)), MYH14(NM_001145809.1):c.6096_6097delAG (p.A2033Pfs*13) - MYH14_000148 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.*6340T>G r.(=) p.(=) - likely benign g.50813032A>C g.50309775A>C MYH14(NM_001145809.1):c.6096A>C (p.P2032=) - MYH14_000147 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6343T>G r.(=) p.(=) - likely benign g.50813029A>C g.50309772A>C MYH14(NM_001145809.1):c.6093A>C (p.P2031=) - MYH14_000146 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. - c.*6347G>T r.(=) p.(=) - VUS g.50813025C>A - - - MYH14_000271 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. - c.*6347_*6348insGC r.(=) p.(=) - likely benign g.50813024_50813025insGC g.50309767_50309768insGC MYH14(NM_001077186.1):c.5989_5990insGC (p.(Ser1997CysfsTer40)) - MYH14_000165 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.*6347_*6348insGGGC r.(=) p.(=) - likely benign g.50813024_50813025insGCCC g.50309767_50309768insGCCC MYH14(NM_001077186.1):c.5989_5990insGCCC (p.(Ser1997CysfsTer18)), MYH14(NM_001145809.1):c.6088_6089insGCCC (p.S2030Cfs*18) - MYH14_000143 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6347_*6348insGGGC r.(=) p.(=) - likely benign g.50813024_50813025insGCCC g.50309767_50309768insGCCC MYH14(NM_001077186.1):c.5989_5990insGCCC (p.(Ser1997CysfsTer18)), MYH14(NM_001145809.1):c.6088_6089insGCCC (p.S2030Cfs*18) - MYH14_000143 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. - c.*6348A>T r.(=) p.(=) - likely benign g.50813024T>A g.50309767T>A MYH14(NM_001145809.1):c.6088T>A (p.S2030T) - MYH14_000164 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*6349C>A r.(=) p.(=) - likely benign g.50813023G>T - MYH14(NM_001145809.2):c.6087G>T (p.G2029=) - MYH14_000253 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.*6378C>T r.(=) p.(=) - VUS g.50812994G>A g.50309737G>A MYH14(NM_001145809.2):c.6058G>A (p.G2020R) - MYH14_000142 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.*6424T>A r.(=) p.(=) - benign g.50812948A>T g.50309691A>T MYH14(NM_001145809.2):c.6012A>T (p.L2004=) - MYH14_000076 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.*6445C>T r.(=) p.(=) - likely benign g.50812927G>A - MYH14(NM_001145809.2):c.5991G>A (p.T1997=) - MYH14_000242 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.*7010C>T r.(=) p.(=) - VUS g.50812362G>A g.50309105G>A MYH14(NM_001145809.1):c.5888G>A (p.R1963H) - MYH14_000075 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. - c.*7030G>A r.(=) p.(=) - benign g.50812342C>T g.50309085C>T MYH14(NM_001145809.2):c.5868C>T (p.A1956=) - MYH14_000074 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. - c.*7040C>T r.(=) p.(=) - VUS g.50812332G>A g.50309075G>A MYH14(NM_001145809.1):c.5858G>A (p.R1953Q) - MYH14_000141 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.*7048C>T r.(=) p.(=) - likely benign g.50812324G>A - MYH14(NM_001145809.2):c.5850G>A (p.E1950=) - MYH14_000270 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.*8953C>A r.(=) p.(=) - likely benign g.50810419G>T g.50307162G>T - - MYH14_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
Legend   How to query