All transcript variants in gene KCNQ1

Information The variants shown are described using the NM_000218.2 transcript reference sequence.

1179 entries on 12 pages. Showing entries 1 - 100.
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. _1_1i c.-97652_386+22686del pathogenic r.0? p.0? g.[1565895_2489400delins[(126);ins1565903_1565980;ins1561954_1562005inv;ins1863937_2368676inv;ins1566135_1565981]] - - - KCNQ1_000750 complex rearrangement, see Fig.4 for details PubMed: Beygo 2016, Journal: Beygo 2016 - - Germline yes - - 0 - Jasmin Beygo
-/. 1 c.-5T>C - r.(=) p.(=) g.2466324T>C - 1-5T>C - KCNQ1_000760 data copied from the Inherited arrhythmogenic diseases and cardiac ion channels database PubMed: Jongbloed 2002 - - Germline - 0.10 - 0 - Johan den Dunnen
-/. - c.-5T>C benign r.(?) p.(=) g.2466324T>C - KCNQ1(NM_000218.2):c.-5T>C - KCNQ1_000760 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-?/. - c.-5T>C likely benign r.(?) p.(=) g.2466324T>C - KCNQ1(NM_000218.2):c.-5T>C - KCNQ1_000760 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-?/. - c.-5T>C likely benign r.(?) p.(=) g.2466324T>C - KCNQ1(NM_000218.2):c.-5T>C - KCNQ1_000760 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 11i c.1514+37100_1514+37140|bsrC - r.(=) p.(=) g.2720411_2720451||bsrC - KvDMR CG1-CG6 - KCNQ1_000000 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 normal levels Johan den Dunnen
+?/. 11i c.1514+37100|bsrC - r.(=) p.(=) g.2720411||bsrC - KvDMR CG1 - KCNQ1_000345 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 0.49 (controls 0.49-0.66) Johan den Dunnen
+?/. 11i c.1514+37107|bsrC - r.(=) p.(=) g.2720418||bsrC - KvDMR CG2 - KCNQ1_000346 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 0.52 (controls 0.52-0.68) Johan den Dunnen
+?/. 11i c.1514+37119|bsrC - r.(=) p.(=) g.2720430||bsrC - KvDMR CG3 - KCNQ1_000347 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 0.44 (controls 0.41-0.54) Johan den Dunnen
+?/. 11i c.1514+37121|bsrC - r.(=) p.(=) g.2720432||bsrC - KvDMR CG4 - KCNQ1_000348 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 0.46 (controls 0.42-0.55) Johan den Dunnen
+?/. 11i c.1514+37133|bsrC - r.(=) p.(=) g.2720444||bsrC - KvDMR CG5 - KCNQ1_000349 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 0.55 (controls 0.55-0.72) Johan den Dunnen
+?/. 11i c.1514+37140|bsrC - r.(=) p.(=) g.2720451||bsrC - KvDMR CG6 - KCNQ1_000350 normal methylation Kv-DMR (ICR2) PubMed: Kagami 2014 - - Somatic - - - 0 0.52 (controls 0.55-0.71) Johan den Dunnen
+/. 5 c.726C>R - r.(?) p.(Asp242Glu) g.2593285C>R - D242E - KCNQ1_000791 data from Inherited Arrhythmias web site AHA2001 meeting abstracts - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.? - r.? p.? g.2549205C>T - S145L - KCNQ1_000000 data from Inherited Arrhythmias web site PubMed: Liu 2006 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.5C>T - r.(?) p.(Ala2Val) g.2466333C>T - C5T - KCNQ1_000802 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.19C>T - r.(?) p.(Pro7Ser) g.2466347C>T - C19T - KCNQ1_000803 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. - c.108insT - r.(?) p.(?) g.? - 108insT - DRD4_000002 data from Inherited Arrhythmias web site (grammar): Expected W:(acgt...) (at char 17), (line:1, col:18) PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
?/. - c.113T>C VUS r.(?) p.(Leu38Pro) g.2466441T>C - KCNQ1(NM_000218.2):c.113T>C (p.L38P) - KCNQ1_001026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
-/. - c.118C>T benign r.(?) p.(=) g.2466446C>T - KCNQ1(NM_000218.2):c.118C>T (p.=) - KCNQ1_001027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. 1 c.136G>A - r.(?) p.(Ala46Thr) g.2466464G>A - G136A - KCNQ1_000804 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - 0 - Johan den Dunnen
?/. - c.136G>A VUS r.(?) p.(Ala46Thr) g.2466464G>A - KCNQ1(NM_000218.2):c.136G>A (p.(Ala46Thr)) - KCNQ1_000804 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. 1 c.151_152insT - r.(?) p.(Tyr51Leufs*234) g.2466479_2466480insT - 151_152insT - KCNQ1_000805 data from Inherited Arrhythmias web site (variantchecker): Insertion of T at position 259_260 was given, however, the HGVS notation prescribes that it should be a duplication of T at position 259_259. PubMed: Napolitano 2005 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.153C>G - r.(?) p.(Tyr51*) g.2466481C>G - C153G - KCNQ1_000806 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
?/. - c.153_154insCGCGCCCAT VUS r.(?) p.(Tyr51_Ala52insArgAlaHis) g.2466481_2466482insCGCGCCCAT - KCNQ1(NM_000218.2):c.152_153insCGCGCCCAT (p.(Ile54_Pro56dup), p.(Tyr51_Ala52insAlaProIle)) - KCNQ1_001064 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-/. 1 c.160_168dup - r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - 160_168dup - KCNQ1_000801 data from Inherited Arrhythmias web site PubMed: Ackerman 2003 - - Germline - - - 0 - Johan den Dunnen
-/. 1 c.160_168dup - r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - 160_168dup - KCNQ1_000801 data from Inherited Arrhythmias web site PubMed: Abraham 2010 - - Germline - - - 0 - Johan den Dunnen
-/- 1 c.160_168dup - r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - dup160-168 - KCNQ1_000801 - PubMed: Ackerman 2003 - - Germline - 4/305 controls - 0 - Johan den Dunnen
?/. - c.160_168dup VUS r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - KCNQ1:NM_000218.2:c.152_153insCGCGCCCAT - KCNQ1_000801 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - VKGL-NL_Leiden
?/. - c.160_168dup VUS r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - KCNQ1(NM_000218.2):c.160_168dupATCGCGCCC (p.I54_P56dup) - KCNQ1_000801 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. - c.160_168dup benign r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - KCNQ1(NM_000218.2):c.160_168dupATCGCGCCC (p.I54_P56dup) - KCNQ1_000801 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.160_168dup likely benign r.(?) p.(Ile54_Pro56dup) g.2466488_2466496dup - KCNQ1(NM_000218.2):c.160_168dupATCGCGCCC (p.I54_P56dup) - KCNQ1_000801 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/. 1 c.176delC - r.(?) p.(Pro59Glnfs*27) g.2466504delC - 176delC - KCNQ1_000807 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.190_210del - r.(?) p.(Pro64_Pro70del) g.2466518_2466538del - 190_210delCCTGCGTCCCCGGCCGCGCCC - KCNQ1_000761 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+?/. - c.190_210del likely pathogenic r.(?) p.(Pro64_Pro70del) g.2466518_2466538del - KCNQ1(NM_000218.2):c.182_202del (p.(Pro64_Pro70del)) - KCNQ1_000761 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
-?/. - c.194C>T likely benign r.(?) p.(Ala65Val) g.2466522C>T - KCNQ1(NM_000218.2):c.194C>T (p.A65V) - KCNQ1_001029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. 1 c.197C>T - r.(?) p.(Ser66Phe) g.2466525C>T - C197T - KCNQ1_000808 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.200_210del - r.(?) p.(Pro67Argfs*214) g.2466528_2466538del - 200_210delCGGCCGCGCCC - KCNQ1_000762 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
-/. - c.207G>T benign r.(?) p.(=) g.2466535G>T - KCNQ1(NM_000218.2):c.207G>T (p.A69=) - KCNQ1_001030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Utrecht
-/. - c.207G>T benign r.(?) p.(=) g.2466535G>T - KCNQ1(NM_000218.2):c.207G>T (p.A69=) - KCNQ1_001030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. - c.207G>T likely benign r.(?) p.(=) g.2466535G>T - KCNQ1(NM_000218.2):c.207G>T (p.A69=) - KCNQ1_001030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. - c.207G>T likely benign r.(?) p.(=) g.2466535G>T - KCNQ1(NM_000218.2):c.207G>T (p.A69=) - KCNQ1_001030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 c.211_219del - r.(?) p.(Ala71_Pro73del) g.2466539_2466547del - 211_219del - KCNQ1_000774 data from Inherited Arrhythmias web site PubMed: Ackerman 1999 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.211_219del - r.(?) p.(Ala71_Pro73del) g.2466539_2466547del - del 211–219 - KCNQ1_000774 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.211_219del - r.(?) p.(Ala71_Pro73del) g.2466539_2466547del - AAPdel71–73 - KCNQ1_000774 data from Inherited Arrhythmias web site PubMed: Choi 2004 - - Germline - - - 0 - Johan den Dunnen
?/. 1 c.217C>A - r.(?) p.(Pro73Thr) g.2466545C>A g.2445315C>A - - KCNQ1_000239 - PubMed: Riuro 2014 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.217C>A - r.(?) p.(Pro73Thr) g.2466545C>A g.2445315C>A C217A - KCNQ1_000239 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
?/. - c.217C>A VUS r.(?) p.(Pro73Thr) g.2466545C>A - KCNQ1(NM_000218.2):c.217C>A (p.P73T) - KCNQ1_000239 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
?/. - c.217C>A VUS r.(?) p.(Pro73Thr) g.2466545C>A - KCNQ1(NM_000218.2):c.217C>A (p.P73T) - KCNQ1_000239 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
?/. - c.217C>A VUS r.(?) p.(Pro73Thr) g.2466545C>A - KCNQ1(NM_000218.2):c.217C>A (p.P73T) - KCNQ1_000239 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 c.220_221delCC - r.(?) p.(Pro74Serfs*210) g.2466548_2466549delCC g.2445318_2445319delCC 220_221delCC - KCNQ1_000746 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.242_264delinsGCGCCCGCGG - r.(?) p.(Pro81Argfs*152) g.2466570_2466592delinsGCGCCCGCGG - 242_264delCGCGGCCGCCGGTGAGCCTAGACinsGCGCCCGCGG - KCNQ1_000763 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+?/. - c.270del ACMG: 4 r.(?) p.(Val91Serfs*146) g.2466598del - - - KCNQ1_001110 ACMG grading: PM2,PVS1 - - - Germline - - - 0 - Andreas Laner
+/. 1 c.273_299delinsTG - r.(?) p.(Ser92Glyfs*137) g.2466601_2466627delinsTG - 273_299delCTCCATCTACAGCACGCGCCGCCCGGTinsGG - KCNQ1_000764 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. 1 c.287del - r.(?) p.(Thr96Serfs*141) g.2466615del - delC287 - KCNQ1_000809 - PubMed: Tester 2005 - - Germline - 1/541 cases LQT - 0 - Johan den Dunnen
+/. 1 c.298delG - r.(?) p.(Val100Cysfs*137) g.2466626delG g.2445396delG 298delG - KCNQ1_000745 - - - - Germline - - - 0 - Hideki Itoh
-/. 1 c.328A>G - r.(?) p.(?) g.2466656A>G - A328G - KCNQ1_000810 data from Inherited Arrhythmias web site (variantchecker): A not found at position 436, found G instead. PubMed: Ackerman 2003 - - Germline - - - 0 - Johan den Dunnen
+/. - c.328G>A - r.(?) p.(Val110Ile) g.2466656G>A g.2445426G>A - - KCNQ1_000756 - PubMed: Sahlin 2019, Journal: Sahlin 2019 - - Germline ? - - - - Ellika Sahlin
+/. - c.328G>A - r.(?) p.(Val110Ile) g.2466656G>A g.2445426G>A - - KCNQ1_000756 - PubMed: Sahlin 2019, Journal: Sahlin 2019 - - Germline ? - - - - Ellika Sahlin
-/- 1 c.328G>A - r.(?) p.(Val110Ile) g.2466656G>A g.2445426G>A - - KCNQ1_000756 - PubMed: Ackerman 2003 - - Germline - 1/187 controls - 0 - Johan den Dunnen
+/. 1 c.332A>G - r.(?) p.(Tyr111Cys) g.2466660A>G g.2445430A>G - - KCNQ1_000654 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.332A>G - r.(?) p.(Tyr111Cys) g.2466660A>G g.2445430A>G - - KCNQ1_000654 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.332A>G - r.(?) p.(Tyr111Cys) g.2466660A>G g.2445430A>G - - KCNQ1_000654 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.332A>G - r.(?) p.(Tyr111Cys) g.2466660A>G g.2445430A>G A332G - KCNQ1_000654 data from Inherited Arrhythmias web site PubMed: Splawski 2000 - - Germline - - - 0 - Johan den Dunnen
+/. - c.332A>G pathogenic r.(?) p.(Tyr111Cys) g.2466660A>G - KCNQ1(NM_000218.2):c.332A>G (p.Y111C) - KCNQ1_000654 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
?/. 1 c.334_336dup - r.(?) p.(Asn112dup) g.2466662_2466664dup g.2445432_2445434dup - - KCNQ1_000655 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.341T>C - r.(?) p.(Leu114Pro) g.2466669T>C - T341C - KCNQ1_000811 data from Inherited Arrhythmias web site PubMed: Jongbloed 2002 - - Germline - - - 0 - Johan den Dunnen
+/. - c.341T>C pathogenic r.(?) p.(Leu114Pro) g.2466669T>C - KCNQ1(NM_000218.2):c.341T>C - KCNQ1_000811 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 c.344A>G - r.(?) p.(Glu115Gly) g.2466672A>G - A344G - KCNQ1_000812 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
-/. - c.345G>A benign r.(?) p.(=) g.2466673G>A - KCNQ1(NM_000218.2):c.345G>A (p.=) - KCNQ1_001057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL
+/. 1 c.350C>T - r.(?) p.(Pro117Leu) g.2466678C>T g.2445448C>T - - KCNQ1_000656 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.350C>T - r.(?) p.(Pro117Leu) g.2466678C>T g.2445448C>T C350T - KCNQ1_000656 data from Inherited Arrhythmias web site PubMed: Schwartz 2001 - - Germline - - - 0 - Johan den Dunnen
?/. 1 c.355G>C - r.(?) p.(Gly119Arg) g.2466683G>C g.2445453G>C - - KCNQ1_000657 - - - - Germline - - - 0 - Hideki Itoh
-/. 1 c.356G>A - r.(?) p.(Gly119Asp) g.2466684G>A - G356A - KCNQ1_000813 data from Inherited Arrhythmias web site PubMed: Koo SH 2006 - - Germline - - - 0 - Johan den Dunnen
?/. - c.356G>T VUS r.(?) p.(Gly119Val) g.2466684G>T - KCNQ1(NM_000218.2):c.356G>T - KCNQ1_001065 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.356_357delinsTT VUS r.(?) p.(Gly119Val) g.2466684_2466685delinsTT - KCNQ1(NM_000218.2):c.356_357delinsTT - KCNQ1_001066 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
?/. - c.357C>T VUS r.(?) p.(=) g.2466685C>T - KCNQ1(NM_000218.2):c.357C>T - KCNQ1_001067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 c.365G>A - r.(?) p.(Cys122Tyr) g.2466693G>A - G365A - KCNQ1_000814 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
+/. - c.365insT - r.(?) p.(?) g.? - 365insT - DRD4_000002 data from Inherited Arrhythmias web site (grammar): Expected W:(acgt...) (at char 17), (line:1, col:18) PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
?/. 1 c.376C>G - r.(?) p.(His126Asp) g.2466704C>G g.2445474C>G - - KCNQ1_000658 - - - - Germline - - - 0 - Hideki Itoh
+/. 1 c.381C>A - r.(?) p.(Phe127Leu) g.2466709C>A - C381A - KCNQ1_000815 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
-/. 1 c.385G>A - r.(?) p.(Val129Ile) g.2466713G>A - G385A - KCNQ1_000816 data from Inherited Arrhythmias web site PubMed: Ackerman 2003 - - Germline - - - 0 - Johan den Dunnen
-/- 1 c.385G>A - r.(?) p.(Val129Ile) g.2466713G>A - - - KCNQ1_000816 - PubMed: Ackerman 2003 - - Germline - 1/305 controls - 0 - Johan den Dunnen
+/. 1i c.386+1G>A - r.spl? p.(?) g.2466715G>A - G386+1A - KCNQ1_000817 data from Inherited Arrhythmias web site (variantchecker): Intronic position given for a non-genomic reference sequence. PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
?/. 1i c.386+5G>A - r.spl? p.? g.2466719G>A g.2445489G>A - - KCNQ1_000659 - - - - Germline - - - 0 - Hideki Itoh
-/. - c.387-97G>C benign r.(=) p.(=) g.2549061G>C - KCNQ1(NM_000218.2):c.387-97G>C - KCNQ1_001068 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. - c.387-5T>A ACMG: 5 r.spl? p.? g.2549153T>A g.2527923T>A - - KCNQ1_000754 - Trujillano et al., submitted - - Germline - - - 0 - Daniel Trujillano
-/. 2i c.387+217C>T - r.(?) p.(?) g.2549375C>T - 387+217C>T - KCNQ1_000829 data from Inherited Arrhythmias web site (variantchecker): Intronic position given for a non-genomic reference sequence. PubMed: Jongbloed 2002 - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.397G>A - r.(?) p.(Val133Ile) g.2549168G>A - G397A - KCNQ1_000818 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.401T>C - r.(?) p.(Leu134Pro) g.2549172T>C - T401C - KCNQ1_000819 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.403delG - r.(?) p.(Val135Serfs*102) g.2549174delG - 403delG - KCNQ1_000820 data from Inherited Arrhythmias web site PubMed: Kapplinger 2009 - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.407G>T - r.(?) p.(Cys136Phe) g.2549178G>T - G407T - KCNQ1_000821 data from Inherited Arrhythmias web site PubMed: Tester 2005 - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.409C>T - r.(?) p.(Leu137Phe) g.2549180C>T - C409T - KCNQ1_000822 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - 0 - Johan den Dunnen
+/. 2 c.418A>G - r.(?) p.(Ser140Gly) g.2549189A>G - A418G - KCNQ1_000823 data from Inherited Arrhythmias web site PubMed: Chen 2003 - - Germline - - - 0 - Johan den Dunnen
+/. - c.421G>A pathogenic r.(?) p.(Val141Met) g.2549192G>A - KCNQ1(NM_000218.2):c.421G>A (p.Val141Met) - KCNQ1_001069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 c.430A>G - r.(?) p.(Thr144Ala) g.2549201A>G - A430G - KCNQ1_000824 data from Inherited Arrhythmias web site PubMed: Zareba 2003 - - Germline - - - 0 - Johan den Dunnen
-/. 2 c.435C>T - r.(=) p.(=) g.2549206C>T - C435T - KCNQ1_000825 data from Inherited Arrhythmias web site PubMed: Itoh 1998 - - Germline - - - 0 - Johan den Dunnen
-/. 2 c.435C>T - r.(=) p.(=) g.2549206C>T - C435T - KCNQ1_000825 data from Inherited Arrhythmias web site PubMed: Iwasa 2000 - - Germline - - - 0 - Johan den Dunnen
-/. - c.435C>T benign r.(?) p.(=) g.2549206C>T - KCNQ1(NM_000218.2):c.435C>T (p.=) - KCNQ1_000825 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_AMC
-/. - c.435C>T benign r.(?) p.(=) g.2549206C>T - KCNQ1(NM_000218.2):c.435C>T (p.=) - KCNQ1_000825 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 2 c.436G>A - r.(?) p.(Glu146Lys) g.2549207G>A - G436A - KCNQ1_000826 data from Inherited Arrhythmias web site PubMed: Napolitano 2005 - - Germline - - - 0 - Johan den Dunnen
Legend   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »