Unique variants in the LUZP4 gene

Information The variants shown are described using the NM_016383.3 transcript reference sequence.

20 entries on 1 page. Showing entries 1 - 20.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-/. 1 - c.320A>T r.(?) p.(Asn107Ile) - benign g.114537961A>T g.115303396A>T LUZP4(NM_016383.4):c.320A>T (p.N107I) - LUZP4_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.472_474del r.(?) p.(His158del) - likely benign g.114540899_114540901del g.115306334_115306336del LUZP4(NM_016383.4):c.472_474delCAT (p.H158del) - LUZP4_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.537G>A r.(=) p.(=) - likely benign g.114540964G>A g.115306399G>A Q179Q - LUZP4_000015 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - - - Lucy Raymond
-?/. 1 - c.597T>C r.(=) p.(=) - likely benign g.114541024T>C g.115306459T>C G199G - LUZP4_000016 recurrent, found 7 times PubMed: Tarpey 2009 - - Germline - 7/208 cases - - - Lucy Raymond
-?/. 1 - c.600A>G r.(=) p.(=) - likely benign g.114541027A>G g.115306462A>G Q200Q - LUZP4_000017 recurrent, found 25 times PubMed: Tarpey 2009 - - Germline - 25/208 cases - - - Lucy Raymond
-?/. 1 - c.603T>A r.(=) p.(=) - likely benign g.114541030T>A g.115306465T>A S201S - LUZP4_000018 recurrent, found 8 times PubMed: Tarpey 2009 - - Germline - 8/208 cases - - - Lucy Raymond
-?/. 1 - c.614A>C r.(?) p.(His205Pro) - likely benign g.114541041A>C g.115306476A>C LUZP4(NM_016383.4):c.614A>C (p.H205P) - LUZP4_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.618C>T r.(=) p.(=) - likely benign g.114541045C>T g.115306480C>T G206G - LUZP4_000019 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - 4/208 cases - - - Lucy Raymond
-?/. 1 - c.677A>G r.(?) p.(His226Arg) - likely benign g.114541104A>G g.115306539A>G LUZP4(NM_016383.4):c.677A>G (p.H226R) - LUZP4_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.697C>T r.(?) p.(Arg233Cys) - likely benign g.114541124C>T - LUZP4(NM_016383.3):c.697C>T (p.(Arg233Cys)) - LUZP4_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.770A>G r.(?) p.(Lys257Arg) - VUS g.114541197A>G g.115306632A>G LUZP4(NM_016383.3):c.770A>G (p.(Lys257Arg)) - LUZP4_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.770_790del r.(?) p.(Lys257_Gln263del) - VUS g.114541197_114541217del - LUZP4(NM_016383.4):c.770_790delAAGATCTCATAGCCACTCAGA (p.K257_Q263del) - LUZP4_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.791G>A r.(?) p.(Arg264Lys) - VUS g.114541218G>A g.115306653G>A LUZP4(NM_016383.3):c.791G>A (p.(Arg264Lys)) - LUZP4_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.820A>G r.(?) p.(Ile274Val) - likely benign g.114541247A>G g.115306682A>G LUZP4(NM_016383.4):c.820A>G (p.I274V) - LUZP4_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.820_840del r.(?) p.(Ile274_Leu280del) - VUS g.114541247_114541267del g.115306682_115306702del LUZP4(NM_016383.3):c.804_824del (p.(Ile274_Leu280del)) - LUZP4_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.824T>C r.(?) p.(Val275Ala) - VUS g.114541251T>C g.115306686T>C LUZP4(NM_016383.3):c.824T>C (p.(Val275Ala)) - LUZP4_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.829C>G r.(?) p.(Gln277Glu) - likely benign g.114541256C>G g.115306691C>G LUZP4(NM_016383.3):c.829C>G (p.(Gln277Glu)) - LUZP4_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.829_849dup r.(?) p.(Gln277_Thr283dup) - VUS g.114541256_114541276dup g.115306691_115306711dup LUZP4(NM_016383.3):c.824_825insCACTCAGAGAGATCTCGTGGC (p.(Val275_Thr276insThrGlnArgAspLeuValAla)) - LUZP4_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.*262G>A r.(=) p.(=) - VUS g.114541631G>A g.115307066G>A - - LUZP4_000004 - - - - Germline - - - - - Yu Sun
?/. 2 - c.*394T>C r.(=) p.(=) - VUS g.114541763T>C g.115307198T>C - - LUZP4_000001 - - - - Germline - - - - - Yu Sun
Legend   How to query