Unique variants in the NIPA1 gene

Information The variants shown are described using the NM_144599.4 transcript reference sequence.

24 entries on 1 page. Showing entries 1 - 24.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 1 - c.-25_*5550[2] r.= p.= - VUS g.(22500000_22756504)_(23088787_23100000)dup - g.22756504_23088787dup - CYFIP1_000005 - PubMed: Giugliano 2018 - - Germline - - - - - Teresa Giugliano
-?/., ?/. 2 - c.39_47del r.(?) p.(Ala14_Ala16del) - likely benign, VUS g.23086382_23086390del g.22786678_22786686del 1 more item - NIPA1_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht
-?/., ?/. 5 - c.42_47dup r.(?) p.(Ala15_Ala16dup) - likely benign, VUS g.23086385_23086390dup g.22786678_22786683dup 1 more item - NIPA1_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_AMC
-/., -?/. 4 - c.45_47del r.(?) p.(Ala16del) - benign, likely benign g.23086388_23086390del g.22786678_22786680del NIPA1(NM_001142275.1):c.-48+453_-48+455del (p.(=)), NIPA1(NM_144599.5):c.45_47delGGC (p.A16del) - NIPA1_000012, NIPA1_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/., ?/. 4 - c.45_47dup r.(?) p.(Ala16dup) - likely benign, VUS g.23086388_23086390dup g.22786678_22786680dup 1 more item - NIPA1_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 1 - c.75C>T r.(?) p.(Pro25=) - likely benign g.23086337G>A g.22786731C>T NIPA1(NM_144599.4):c.75C>T (p.P25=) - NIPA1_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.88_114dup r.(?) p.(Leu30_Ser38dup) - VUS g.23086305_23086331dup g.22786737_22786763dup NIPA1(NM_144599.4):c.88_114dupCTCGGCCTGGGCGTGGCCGTCGTGTCG (p.L30_S38dup) - NIPA1_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.109G>A r.(?) p.(Val37Met) - likely benign g.23086303C>T - NIPA1(NM_144599.4):c.109G>A (p.(Val37Met)) - NIPA1_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.134C>G r.(?) p.(Thr45Arg) ACMG pathogenic g.23086278G>C g.22786790C>G - - NIPA1_000029 1 more item - - rs104894496 Germline - - - - - Andreas Laner
?/. 1 - c.139G>A r.(?) p.(Val47Met) - VUS g.23086273C>T - - - NIPA1_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/., ?/. 2 - c.242T>C r.(?) p.(Ile81Thr) - likely benign, VUS g.23060890A>G g.22812178T>C NIPA1(NM_144599.4):c.242T>C (p.(Ile81Thr)) - NIPA1_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Nijmegen
?/. 1 - c.257C>G r.(?) p.(Ala86Gly) - VUS g.23060875G>C g.22812193C>G - - NIPA1_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 2 - c.291C>G r.(?) p.(Pro97=) - likely benign g.23060841G>C g.22812227C>G NIPA1(NM_144599.5):c.291C>G (p.P97=) - NIPA1_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
-?/. 3 - c.312G>A r.(?) p.(Pro104=) - likely benign g.23060820C>T g.22812248G>A NIPA1(NM_144599.4):c.312G>A (p.P104=), NIPA1(NM_144599.5):c.312G>A (p.P104=) - NIPA1_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_AMC
+/. 1 - c.316G>A r.(?) p.Gly106Arg ACMG pathogenic g.23060816C>T g.22812252G>A - - NIPA1_000021 1 more item - - rs104894490 Germline - - - - - Andreas Laner
-/. 1 - c.317+1421G>A r.(=) p.(=) - benign g.23059394C>T g.22813674G>A NIPA1(NM_144599.5):c.317+1421G>A - NIPA1_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 3 - c.441A>G r.(?) p.(Thr147=) - benign g.23052632T>C g.22820436A>G NIPA1(NM_144599.5):c.441A>G (p.T147=) - NIPA1_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Nijmegen, VKGL-NL_AMC
?/. 1 - c.484G>A r.(?) p.(Val162Met) - VUS g.23049335C>T g.22823733G>A NIPA1(NM_144599.5):c.484G>A (p.V162M) - NIPA1_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.537C>T r.(?) p.(Ile179=) - likely benign g.23049282G>A g.22823786C>T NIPA1(NM_144599.4):c.537C>T (p.I179=) - NIPA1_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.607G>A r.(?) p.(Val203Met) - VUS g.23049212C>T - - - NIPA1_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 1 - c.731A>G r.(?) p.(Gln244Arg) - pathogenic g.23049088T>C g.22823980A>G - - NIPA1_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.753G>C r.(?) p.(Ala251=) - likely benign g.23049066C>G g.22824002G>C NIPA1(NM_144599.4):c.753G>C (p.A251=) - NIPA1_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.801G>A r.(?) p.(Val267=) - likely benign g.23049018C>T g.22824050G>A NIPA1(NM_144599.4):c.801G>A (p.V267=) - NIPA1_000001 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.*5331T>G r.(=) p.(=) - likely benign g.23043498A>C g.22829570T>G - - NIPA1_000028 1 homozygous; Clinindb (India), 3 heterozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs73412681 Germline - 1/2795 individuals, 3/2795 individuals - - - Mohammed Faruq
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.