Unique variants in gene POU3F3

Information The variants shown are described using the NM_006236.1 transcript reference sequence.

20 entries on 1 page. Showing entries 1 - 20.
Legend  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

ClassClinical     

RNA change     

Protein     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. 1 - c.189C>A pathogenic (dominant) r.(?) p.(Tyr63*) g.105472157C>A g.104855699C>A - - POU3F3_000008 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.196_197delinsT pathogenic (dominant) r.(?) p.(Asp66Serfs*26) g.105472164_105472165delinsT g.104855706_104855707delinsT - - POU3F3_000009 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
?/., +/. 2 - c.246_267del VUS, pathogenic (dominant) r.(?) p.(Met82Ilefs*3) g.105472214_105472235del g.104855756_104855777del POU3F3(NM_006236.2):c.246_267delGGCCGCCAGCAACGGCGGCCAT (p.M82Ifs*3) - POU3F3_000001 VKGL data sharing initiative Nederland PubMed: Snijders Blok 2019 - - CLASSIFICATION record, De novo - - - - - VKGL-NL, Johan den Dunnen
-/. 1 - c.327_329del benign r.(?) p.(Ala115del) g.105472295_105472297del - POU3F3(NM_006236.2):c.327_329delCGC (p.A115del) - POU3F3_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.366_367del pathogenic (dominant) r.(?) p.(Trp122Cysfs*517) g.105472334_105472335del g.104855876_104855877del - - POU3F3_000003 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.436_437dup pathogenic (dominant) r.(?) p.(Pro147Alafs*4) g.105472404_105472405dup g.104855946_104855947dup - - POU3F3_000010 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.524del pathogenic (dominant) r.(?) p.(Pro175Argfs*56) g.105472492del g.104856034del - - POU3F3_000011 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.668C>A pathogenic (dominant) r.(?) p.(Ser223*) g.105472636C>A g.104856178C>A - - POU3F3_000012 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.774del pathogenic (dominant) r.(?) p.(Leu259Trpfs*110) g.105472742del g.104856284del - - POU3F3_000013 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
-?/. 1 - c.829_831del likely benign r.(?) p.(His277del) g.105472797_105472799del - POU3F3(NM_006236.2):c.829_831delCAC (p.H277del) - POU3F3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 1 - c.992_1006del pathogenic (dominant) r.(?) p.(Gln331_Lys335del) g.105472960_105472974del g.104856502_104856516del - - POU3F3_000014 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 2 - c.1085G>T pathogenic (dominant) r.(?) p.(Arg362Leu) g.105473053G>T g.104856595G>T - - POU3F3_000015 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.1197del pathogenic (dominant) r.(?) p.(Ile400Serfs*16) g.105473165del g.104856707del - - POU3F3_000016 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
?/., +/. 2 - c.1219C>G VUS, pathogenic (dominant) r.(?) p.(Arg407Gly) g.105473187C>G g.104856729C>G POU3F3(NM_006236.2):c.1219C>G (p.Arg407Gly) - POU3F3_000004 VKGL data sharing initiative Nederland PubMed: Snijders Blok 2019 - - CLASSIFICATION record, De novo - - - - - VKGL-NL, Johan den Dunnen
+/. 1 - c.1220G>T pathogenic (dominant) r.(?) p.(Arg407Leu) g.105473188G>T g.104856730G>T - - POU3F3_000017 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
+/. 1 - c.1240G>T pathogenic (dominant) r.(?) p.(Glu414*) g.105473208G>T g.104856750G>T - - POU3F3_000018 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
?/., +/. 2 - c.1284C>A VUS, pathogenic (dominant) r.(?) p.(Cys428*) g.105473252C>A g.104856794C>A POU3F3(NM_006236.1):c.1284C>A (p.Cys428*) - POU3F3_000005 VKGL data sharing initiative Nederland PubMed: Snijders Blok 2019 - - CLASSIFICATION record, De novo - - - - - VKGL-NL, Johan den Dunnen
?/. 1 - c.1303_1305del VUS r.(?) p.(Glu435del) g.105473271_105473273del - POU3F3(NM_006236.2):c.1303_1305delGAG (p.E435del) - POU3F3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL
+/. 2 - c.1352_1362del pathogenic (dominant) r.(?) p.(Arg451Leufs*185) g.105473320_105473330del g.104856862_104856872del - - POU3F3_000019 - PubMed: Snijders Blok 2019 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
+/. 1 - c.1367A>G pathogenic (dominant) r.(?) p.(Asn456Ser) g.105473335A>G g.104856877A>G - - POU3F3_000020 - PubMed: Snijders Blok 2019 - - De novo - - - - - Johan den Dunnen
Legend