All variants in the PRNP gene

Information The variants shown are described using the NM_000311.3 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+/. - c.227_228ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] r.227_228ins[ucauggugguggcugggggcagcc[2];ccauggugguggcuggggacagcc;ucauggugguggcugggggcagcc[5]] p.(Gln91_Gly92insProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGlnProHisGlyGlyGlyTrpGlyGln) - - pathogenic g.4680093_4680094ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] g.4699447_4699448ins[TCATGGTGGTGGCTGGGGGCAGCC[2];CCATGGTGGTGGCTGGGGACAGCC;TCATGGTGGTGGCTGGGGGCAGCC[5]] - - PRNP_000064 - PubMed: Lee 2019 ClinVar-000992388.1 - Germline/De novo (untested) - - - 0 - Johan den Dunnen
Legend   How to query