All variants in the PRNP gene

Information The variants shown are described using the NM_000311.3 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







-/. - c.228_251del r.(?) p.(Pro84_Gln91del) - - benign g.4680094_4680117del g.4699448_4699471del PRNP(NM_000311.4):c.228_251delCCATGGTGGTGGCTGGGGACAGCC (p.P84_Q91del) - PRNP_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
Legend   How to query