All variants in the PRNP gene

Information The variants shown are described using the NM_000311.3 transcript reference sequence.

6 entries on 1 page. Showing entries 1 - 6.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Haplotype     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[3] - - likely benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 - {PMID01357594:Bosque 1992} - - Germline - - TthIII1- - - Johan den Dunnen
-/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[4] - - benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 4-haplotype {PMID01347972:Vnencak-Jones 1992} - - Germline - - - - - Johan den Dunnen
-/? 2 c.246_269del r.(?) p.(Pro60_Gln67)[4] - - benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 4-haplotype {PMID01347972:Vnencak-Jones 1992} - - Germline - 6/240 chromosomes - - - Johan den Dunnen
-?/? 2 c.246_269del r.(?) p.(Pro84_Gln91)del - - likely benign g.4680070_4680093del g.4699424_4699447del - - PRNP_000001 Variant Error [EMISMATCH]: This variant seems to mismatch; the genomic and the transcript variant seems to not belong together. Please fix this entry and then remove this message. {PMID07485229:Perry 1995} - - Germline - - - - - Johan den Dunnen
-?/? 2 c.246_269del r.(?) p.(Pro84_Gln91)del - - likely benign g.4680112_4680135del g.4699466_4699489del - - PRNP_000001 4-haplotype {PMID01678248:Puckett 1991} - - Germline - - - - - Johan den Dunnen
-/. - c.246_269del r.(?) p.(Pro84_Gln91del) - - benign g.4680112_4680135del g.4699466_4699489del PRNP(NM_000311.4):c.246_269delACAGCCTCATGGTGGTGGCTGGGG (p.P84_Q91del) - PRNP_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_VUmc
Legend   How to query