Unique variants in the SLC37A4 gene

Information The variants shown are described using the NM_001164277.1 transcript reference sequence.

73 entries on 1 page. Showing entries 1 - 73.
Legend   How to query  




AscendingDNA change (cDNA)     

RNA change     


Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     







+?/. 1 - c.? r.? p.? - likely pathogenic (recessive) g.? - 1211delCT (A400X) - DRD4_000002 - PubMed: Tsangaris 2011 - - Germline - - - - - Johan den Dunnen
+/? 1 3 c.59G>A r.(?) p.(Gly20Asp) - pathogenic g.118900021C>T g.119029311C>T - - SLC37A4_000005 submitted through SIB; ExPASy_025581 PubMed: Veiga-da-Cunha 1998 - - Unknown - - - - - SIB - Livia Famiglietti
+/?, +?/. 2 3 c.70T>C r.(?) p.(Tyr24His) - likely pathogenic, pathogenic g.118900010A>G g.119029300A>G - - SLC37A4_000012 1 heterozygous, no homozygous; Clinindb (India), submitted through SIB; ExPASy_025582 PubMed: Narang 2020, Journal: Narang 2020, PubMed: Yuen 2002 - rs193302887 Germline, Unknown - 1/2795 individuals - - - SIB - Livia Famiglietti, Mohammed Faruq
+/? 1 3 c.81T>A r.(?) p.(Asn27Lys) - pathogenic g.118899999A>T g.119029289A>T - - SLC37A4_000014 submitted through SIB; ExPASy_025583 PubMed: Santer 2000 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 3 c.82C>T r.(?) p.(Arg28Cys) - pathogenic g.118899998G>A g.119029288G>A - - SLC37A4_000006 submitted through SIB; ExPASy_025584 PubMed: Veiga-da-Cunha 1998 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 3 c.83G>A r.(?) p.(Arg28His) - pathogenic g.118899997C>T g.119029287C>T - - SLC37A4_000018 submitted through SIB; ExPASy_016840 PubMed: Hiraiwa 1999 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 3 c.148G>C r.(spl?) p.(Gly50Arg) - pathogenic g.118899932C>G g.119029222C>G - - SLC37A4_000021 submitted through SIB; ExPASy_025585 PubMed: Veiga-da-Cunha 1999 - - Unknown - - - - - SIB - Livia Famiglietti
-/. 1 - c.149-14A>G r.(=) p.(=) - benign g.118899150T>C g.119028440T>C SLC37A4(NM_001164278.2):c.149-14A>G - SLC37A4_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/? 1 4 c.149G>A r.(spl?) p.(Gly50Glu) - pathogenic g.118899136C>T g.119028426C>T - - SLC37A4_000034 submitted through SIB; ExPASy_066394 PubMed: Dissanayake 2011 - - Unknown - - - - - SIB - Livia Famiglietti
-?/. 1 - c.150G>T r.(?) p.(Gly50=) - likely benign g.118899135C>A g.119028425C>A SLC37A4(NM_001164277.1):c.150G>T (p.G50=) - SLC37A4_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/? 1 4 c.162C>A r.(?) p.(Ser54Arg) - pathogenic g.118899123G>T g.119028413G>T - - SLC37A4_000025 submitted through SIB; ExPASy_025586 PubMed: Janecke 2000 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 4 c.163A>C r.(?) p.(Ser55Arg) - pathogenic g.118899122T>G g.119028412T>G - - SLC37A4_000008 submitted through SIB; ExPASy_025587 PubMed: Veiga-da-Cunha 1998 - - Unknown - - - - - SIB - Livia Famiglietti
-?/. 1 - c.183T>C r.(?) p.(Ala61=) - likely benign g.118899102A>G - SLC37A4(NM_001164277.1):c.183T>C (p.(Ala61=)) - SLC37A4_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/? 1 4 c.202G>A r.(?) p.(Gly68Arg) - pathogenic g.118899083C>T g.119028373C>T - - SLC37A4_000009 submitted through SIB; ExPASy_025588 PubMed: Veiga-da-Cunha 1998 - - Unknown - - - - - SIB - Livia Famiglietti
?/. 1 - c.242C>T r.(?) p.(Ser81Phe) - VUS g.118899043G>A g.119028333G>A SLC37A4(NM_001164277.1):c.242C>T (p.S81F) - SLC37A4_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/? 1 4 c.254T>C r.(?) p.(Leu85Pro) - pathogenic g.118899031A>G g.119028321A>G - - SLC37A4_000026 submitted through SIB; ExPASy_025589 PubMed: Chou 2002 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 4 c.263G>A r.(?) p.(Gly88Asp) - pathogenic g.118899022C>T g.119028312C>T - - SLC37A4_000010 submitted through SIB; ExPASy_025590 PubMed: Veiga-da-Cunha 1998 - - Unknown - - - - - SIB - Livia Famiglietti
+/?, ?/? 2 4 c.287G>A r.(?) p.(Trp96*) - pathogenic, VUS g.118898998C>T g.119028288C>T - - SLC37A4_000033 - - - rs121908976 Unknown - - - - - Shu Yau
+/? 1 4 c.352T>C r.(?) p.(Trp118Arg) - pathogenic g.118898933A>G g.119028223A>G - - SLC37A4_000029 submitted through SIB; ExPASy_007850 PubMed: Kure 1998 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 5 c.398A>C r.(?) p.(Gln133Pro) - pathogenic g.118898566T>G g.119027856T>G - - SLC37A4_000023 submitted through SIB; ExPASy_025591 PubMed: Veiga-da-Cunha 1999 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 5 c.443C>T r.(?) p.(Ala148Val) - pathogenic g.118898521G>A g.119027811G>A - - SLC37A4_000003 submitted through SIB; ExPASy_066395 PubMed: Han 2005 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 5 c.446G>A r.(?) p.(Gly149Glu) - pathogenic g.118898518C>T g.119027808C>T - - SLC37A4_000019 submitted through SIB; ExPASy_003184 PubMed: Hiraiwa 1999 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 5 c.448G>A r.(?) p.(Gly150Arg) - pathogenic g.118898516C>T g.119027806C>T - - SLC37A4_000007 submitted through SIB; ExPASy_025592 PubMed: Veiga-da-Cunha 1998 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 5 c.458C>T r.(?) p.(Pro153Leu) - pathogenic g.118898506G>A g.119027796G>A - - SLC37A4_000015 submitted through SIB; ExPASy_025593 PubMed: Santer 2000 - - Unknown - - - - - SIB - Livia Famiglietti
+?/. 1 - c.464_473delinsCCC r.(?) p.(Leu155ProfsTer55) - likely pathogenic (recessive) g.118898491_118898500delinsGGG g.119027781_119027790delinsGGG 464del10ins3C - SLC37A4_000071 - PubMed: Tsangaris 2011 - - Germline - - - - - Johan den Dunnen
-?/., ?/. 3 - c.467C>T r.(?) p.(Ala156Val) - likely benign, VUS g.118898497G>A g.119027787G>A SLC37A4(NM_001164277.1):c.467C>T (p.A156V), [467C>T;572C>G] - SLC37A4_000056 VKGL data sharing initiative Nederland PubMed: Wang 2013 - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - c.492C>T r.(?) p.(Ser164=) - likely benign g.118898472G>A g.119027762G>A SLC37A4(NM_001164277.1):c.492C>T (p.S164=) - SLC37A4_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.497G>A r.(?) p.(Arg166His) - VUS g.118898467C>T g.119027757C>T - - SLC37A4_000060 conflicting interpretations of pathogenicity; 4 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs186476316 Germline - 4/2795 individuals - - - Mohammed Faruq
-/. 1 - c.525_527= r.(=) p.(Leu175=) - benign g.118898437del g.119027727del SLC37A4(NM_001164277.1):c.527delG (p.C176Lfs*36) - SLC37A4_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
+/? 1 5 c.526T>C r.(?) p.(Cys176Arg) - pathogenic g.118898438A>G g.119027728A>G - - SLC37A4_000022 submitted through SIB; ExPASy_025594 PubMed: Veiga-da-Cunha 1999 - - Unknown - - - - - SIB - Livia Famiglietti
+?/. 1 - c.528del r.(?) p.(Cys176Trpfs*36) - likely pathogenic g.118898435del g.119027725del - - SLC37A4_000062 - - - - Unknown - - - - - Cordula Haas
+/? 2 5 c.547T>C r.(?) p.(Cys183Arg) - pathogenic g.118898416A>G g.119027706A>G - - SLC37A4_000020 submitted through SIB; ExPASy_025595 PubMed: Hiraiwa 1999, PubMed: Veiga-da-Cunha 1999 - - Unknown - - - - - SIB - Livia Famiglietti
-?/. 1 - c.556C>T r.(?) p.(Leu186Phe) - likely benign g.118898407G>A g.119027697G>A SLC37A4(NM_001164277.1):c.556C>T (p.L186F) - SLC37A4_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.572C>G r.(?) p.(Pro191Arg) - VUS g.118898391G>C g.119027681G>C [467C>T;572C>G] - SLC37A4_000063 - PubMed: Wang 2013 - - Germline - - - - - LOVD
+/? 2 5 c.572C>T r.(?) p.(Pro191Leu) - pathogenic g.118898392G>A - - - SLC37A4_000013 1 more item PubMed: Lam 2000, PubMed: Yuen 2002 - - Unknown - - - - - SIB - Livia Famiglietti
-?/. 4 - c.593A>T r.(?) p.(Asn198Ile) - likely benign g.118898370T>A g.119027660T>A SLC37A4(NM_001164277.1):c.593A>T (p.N198I, p.(Asn198Ile)) - SLC37A4_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht
+/. 1 - c.595del r.(?) p.(Leu199Trpfs*13) - pathogenic (recessive) g.118898369del g.119027659del 595delC - SLC37A4_000069 - PubMed: Wang 2013 - - Germline - - - - - LOVD
-/. 1 - c.625+14C>T r.(=) p.(=) - benign g.118898324G>A g.119027614G>A SLC37A4(NM_001164278.2):c.626+14C>T - SLC37A4_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/? 1 6 c.686T>C r.(?) p.(Leu229Pro) - pathogenic g.118897745A>G g.119027035A>G - - SLC37A4_000030 submitted through SIB; ExPASy_025597 PubMed: Trioche 2004 - - Unknown - - - - - SIB - Livia Famiglietti
?/. 1 - c.712G>C r.(?) p.(Gly238Arg) - VUS g.118897719C>G - - - TRAPPC4_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/? 1 6 c.736T>C r.(?) p.(Trp246Arg) - pathogenic g.118897695A>G g.119026985A>G - - SLC37A4_000002 submitted through SIB; ExPASy_066396 PubMed: Hsiao 2009 - - Unknown - - - - - SIB - Livia Famiglietti
+?/. 3 - c.752T>C r.(?) p.(Leu251Pro) - likely pathogenic g.118897679A>G g.119026969A>G SLC37A4 c.752T>C, p.(Leu251Pro) - SLC37A4_000072 homozygous PubMed: Mameesh 2017 - - Germline yes - - - - LOVD
?/. 1 - c.784+3A>G r.spl? p.? - VUS g.118897644T>C - SLC37A4(NM_001164277.1):c.784+3A>G - TRAPPC4_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.785-3_786del r.spl p.? - pathogenic (recessive) g.118897397_118897401del g.119026687_119026691del 785-3_786del5 - SLC37A4_000068 - PubMed: Wang 2013 - - Germline - - - - - LOVD
+/. 1 - c.817G>A r.(?) p.(Gly273Ser) - pathogenic (recessive) g.118897366C>T g.119026656C>T - - SLC37A4_000067 - PubMed: Wang 2013 - - Germline - - - - - LOVD
+/? 1 7 c.833T>A r.(?) p.(Ile278Asn) - pathogenic g.118897350A>T g.119026640A>T - - SLC37A4_000027 submitted through SIB; ExPASy_025598 PubMed: Chou 2002 - - Unknown - - - - - SIB - Livia Famiglietti
?/. 2 - c.857G>A r.(?) p.(Arg286Gln) - VUS g.118897326C>T g.119026616C>T SLC37A4(NM_001164277.1):c.857G>A (p.R286Q) - SLC37A4_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/?, ./. 2 8 c.898C>T r.(?) p.(Arg300Cys) ACMG pathogenic g.118896763G>A g.119026053G>A, g.119026054G>A - - SLC37A4_000001 submitted through SIB; ExPASy_066397 PubMed: Trujillano 2017, PubMed: Veiga-da-Cunha 1999 - - Germline, Unknown - - - - - SIB - Livia Famiglietti, Daniel Trujillano
+/? 1 8 c.899G>A r.(?) p.(Arg300His) - pathogenic g.118896762C>T g.119026052C>T - - SLC37A4_000031 submitted through SIB; ExPASy_025599 PubMed: Marcolongo 1998 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 8 c.902A>C r.(?) p.(His301Pro) - pathogenic g.118896759T>G g.119026049T>G - - SLC37A4_000016 submitted through SIB; ExPASy_025600 PubMed: Santer 2000 - - Unknown - - - - - SIB - Livia Famiglietti
?/. 1 - c.984+228C>G r.(=) p.(=) - VUS g.118896449G>C g.119025739G>C SLC37A4(NM_001164278.2):c.1004C>G (p.P335R) - SLC37A4_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.984+247C>T r.(=) p.(=) - benign g.118896430G>A - - - TRAPPC4_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.984+270C>T r.(=) p.(=) - VUS g.118896407G>A g.119025697G>A - - SLC37A4_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.985-48C>T r.(=) p.(=) - benign g.118896087G>A g.119025377G>A SLC37A4(NM_001164277.1):c.985-48C>T - SLC37A4_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
+/?, ?/? 3 9 c.1015G>T r.(?) p.(Gly339Cys) - pathogenic, VUS g.118896009C>A g.119025299C>A - - SLC37A4_000011 submitted through SIB; ExPASy_003185 PubMed: Veiga-da-Cunha 1998 - rs80356490 Unknown - - - - - SIB - Livia Famiglietti, Shu Yau
+/? 1 9 c.1016G>A r.(?) p.(Gly339Asp) - pathogenic g.118896009C>T - - - SLC37A4_000032 1 more item PubMed: Kure 2000 - - Unknown - - - - - SIB - Livia Famiglietti
+?/. 1 - c.1019_1038del r.(?) p.(Phe340CysfsTer55) - likely pathogenic (recessive) g.118895988_118896007del g.119025278_119025297del 1019_1038delTCTCCTCGTATGGCCCCATT - SLC37A4_000070 - PubMed: Tsangaris 2011 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.1024T>C r.(?) p.(Ser342Pro) - pathogenic (recessive) g.118896000A>G g.119025290A>G - - SLC37A4_000066 - PubMed: Wang 2013 - - Germline - - - - - LOVD
+/., +?/. 2 - c.1042_1043del r.(?) p.(Leu348Valfs*53), p.(Leu348ValfsTer53) - likely pathogenic (recessive), pathogenic (recessive) g.118895981_118895982del g.119025271_119025272del 1042_1043delCT - SLC37A4_000065 - PubMed: Tsangaris 2011, PubMed: Wang 2013 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.1043T>C r.(?) p.(Leu348Pro) - pathogenic (recessive) g.118895981A>G g.119025271A>G - - SLC37A4_000064 - PubMed: Wang 2013 - - Germline - - - - - LOVD
-/., -?/. 3 - c.1062C>T r.(?) p.(Asn354=) - benign, likely benign g.118895962G>A g.119025252G>A SLC37A4(NM_001164277.1):c.1062C>T (p.(Asn354=), p.N354=) - SLC37A4_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Utrecht
-/. 1 - c.1063C>T - p.? - benign g.118895962G>A g.119025252G>A - - SLC37A4_000042 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs61730035 Germline - 5/2795 individuals - - - Mohammed Faruq
-?/., ?/. 2 - c.1067G>C r.(?) p.(Ser356Thr) - likely benign, VUS g.118895957C>G g.119025247C>G SLC37A4(NM_001164277.1):c.1067G>C (p.S356T) - SLC37A4_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
+/? 2 9 c.1099G>A r.(?) p.(Ala367Thr) - pathogenic g.118895925C>T g.119025215C>T - - SLC37A4_000017 submitted through SIB; ExPASy_025602 PubMed: Galli 1999, PubMed: Santer 2000 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 9 c.1118C>A r.(?) p.(Ala373Asp) - pathogenic g.118895906G>T g.119025196G>T - - SLC37A4_000028 submitted through SIB; ExPASy_025603 PubMed: Chou 2002 - - Unknown - - - - - SIB - Livia Famiglietti
+/? 1 10 c.1126G>A r.(?) p.(Gly376Ser) - pathogenic g.118895785C>T - - - SLC37A4_000024 1 more item PubMed: Veiga-da-Cunha 1999 - - Unknown - - - - - SIB - Livia Famiglietti
?/. 1 - c.1223C>T r.(?) p.(Thr408Met) - VUS g.118895687G>A - SLC37A4(NM_001164277.1):c.1223C>T (p.T408M) - TRAPPC4_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.1240C>T r.(?) p.(Leu414=) - likely benign g.118895670G>A g.119024960G>A SLC37A4(NM_001164278.2):c.1307C>T (p.P436L) - SLC37A4_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-/. 1 - c.1275C>T r.(?) p.(Ser425=) - benign g.118895635G>A - SLC37A4(NM_001164277.1):c.1275C>T (p.S425=) - SLC37A4_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 2 - c.1276C>T - p.? - likely benign g.118895635G>A g.119024925G>A - - SLC37A4_000059 2 more items PubMed: Narang 2020, Journal: Narang 2020 - rs35010541 Germline - 1/2795 individuals, 155/2795 individuals - - - Mohammed Faruq
-/. 1 - c.1278G>A r.(?) p.(Lys426=) - benign g.118895632C>T - SLC37A4(NM_001164277.1):c.1278G>A (p.(Lys426=)) - SLC37A4_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/. 1 - c.1279G>A - p.? - benign g.118895632C>T g.119024922C>T - - SLC37A4_000058 1 more item PubMed: Narang 2020, Journal: Narang 2020 - rs34871377 Germline - 1/2795 individuals - - - Mohammed Faruq
-?/. 1 - c.*1597G>A r.(=) p.(=) - likely benign g.118894023C>T - TRAPPC4(NM_001318492.1):c.267-8C>T - CCDC84_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query