Unique variants in the SMAD6 gene

This gene is part of the Globin Gene Server databases.
Information The variants shown are described using the NM_005585.4 transcript reference sequence.

139 entries on 2 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2     Next › Last »

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. 1 - c.-991G>C r.(?) p.(=) ACMG VUS g.66994606G>C g.66702268G>C - - SMAD6_000139 - - - - De novo - 1/12 patients - - - Larry Baum
-/. 1 - c.-767C>T r.(?) p.(=) - benign g.66994830C>T g.66702492C>T SMAD6(NR_027654.1):n.157C>T - SMAD6_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.-44C>T r.(?) p.(=) - likely benign g.66995553C>T g.66703215C>T - - SMAD6_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 3 - c.2T>G r.(?) p.0? - pathogenic (!) g.66995598T>G g.66703260T>G - - SMAD6_000061 di-genic inheritance, 2nd variant? PubMed: Timberlake 2017 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
-?/. 1 - c.6C>T r.(?) p.(Phe2=) - likely benign g.66995602C>T - SMAD6(NM_005585.5):c.6C>T (p.F2=) - SMAD6_000096 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.16C>T r.(?) p.(Arg6Cys) - VUS g.66995612C>T - SMAD6(NM_005585.5):c.16C>T (p.(Arg6Cys)) - SMAD6_000134 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.38T>G r.(?) p.(Leu13Arg) - VUS g.66995634T>G g.66703296T>G - - SMAD6_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.41G>A r.(?) p.(Trp14*) - VUS g.66995637G>A - SMAD6(NM_005585.4):c.41G>A (p.(Trp14*)) - SMAD6_000116 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/., ?/. 2 1 c.42G>A r.(42g>a), r.(?) p.(Trp14*) - likely pathogenic, VUS g.66995638G>A g.66703300G>A - - SMAD6_000005 variant not associated with ID phenotype, VKGL data sharing initiative Nederland PubMed: Gilissen 2014 - - CLASSIFICATION record, De novo ? - - - - Marianne Vos (LOVD-team), VKGL-NL_Nijmegen
+/. 4 - c.43C>T r.(?) p.(Arg15*) - pathogenic (!) g.66995639C>T g.66703301C>T - - SMAD6_000062 di-genic inheritance, 2nd variant? PubMed: Timberlake 2017 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
-/., -?/. 3 - c.61G>A r.(?) p.(Asp21Asn) - benign, likely benign g.66995657G>A g.66703319G>A SMAD6(NM_005585.5):c.61G>A (p.(Asp21Asn), p.D21N) - SMAD6_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Nijmegen, VKGL-NL_VUmc
+?/. 1 - c.67G>T r.(?) p.(Glu23Ter) - likely pathogenic g.66995663G>T - SMAD6(NM_005585.4):c.67G>T (p.E23*) - SMAD6_000082 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 2 - c.75C>T r.(?) p.(Gly25=) - likely benign g.66995671C>T g.66703333C>T SMAD6(NM_005585.4):c.75C>T (p.G25=), SMAD6(NM_005585.5):c.75C>T (p.G25=) - SMAD6_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 2 - c.79A>G r.(?) p.(Ser27Gly) - likely benign g.66995675A>G g.66703337A>G SMAD6(NM_005585.4):c.79A>G (p.S27G), SMAD6(NM_005585.5):c.79A>G (p.S27G) - SMAD6_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/., ?/. 3 - c.79_84del r.(?) p.(Ser27_Gly28del) - likely benign, VUS g.66995675_66995680del g.66703337_66703342del 1 more item - SMAD6_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Nijmegen
+?/. 1 - c.79_84dup r.(?) p.(Ser27_Gly28dup) - VUS g.66995675_66995680dup g.66703337_66703342dup - - SMAD6_000126 - PubMed: Mansoorshahi 2024 - rs769605183 Germline - - - - - Johan den Dunnen
?/. 1 - c.79_87del r.(?) p.(Ser27_Gly29del) - VUS g.66995675_66995683del - SMAD6(NM_005585.5):c.79_87del (p.(Ser27_Gly29del)) - SMAD6_000140 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.92_100del r.(?) p.(Gly31_Gly33del) - VUS g.66995688_66995696del g.66703350_66703358del SMAD6(NM_005585.4):c.92_100delGTGGCGGCG (p.G31_G33del) - SMAD6_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.111del r.(?) p.(Ser38Alafs*26) - VUS g.66995707del - SMAD6(NM_005585.5):c.111del (p.(Ser38AlafsTer26)) - SMAD6_000112 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-/., -?/. 3 - c.120C>T r.(?) p.(Gly40=) - benign, likely benign g.66995716C>T g.66703378C>T SMAD6(NM_005585.4):c.120C>T (p.G40=), SMAD6(NM_005585.5):c.120C>T (p.(Gly40=)) - SMAD6_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
-?/., ?/. 2 - c.130G>C r.(?) p.(Glu44Gln) - likely benign, VUS g.66995726G>C g.66703388G>C SMAD6(NM_005585.4):c.130G>C (p.E44Q), SMAD6(NM_005585.5):c.130G>C (p.(Glu44Gln)) - SMAD6_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.135G>A r.(?) p.(Pro45=) - likely benign g.66995731G>A - SMAD6(NM_005585.4):c.135G>A (p.P45=) - SMAD6_000093 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.139C>T r.(?) p.(Pro47Ser) - benign g.66995735C>T g.66703397C>T SMAD6(NM_005585.4):c.139C>T (p.P47S) - SMAD6_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.173C>G r.(?) p.(Ser58Cys) - VUS g.66995769C>G - SMAD6(NM_005585.4):c.173C>G (p.(Ser58Cys)) - SMAD6_000117 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 - c.208del r.(?) p.(Asp70ThrfsTer55) - pathogenic g.66995804del g.66703466del SMAD6(NM_005585.4):c.208delG (p.D70Tfs*55) - SMAD6_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.210C>G r.(?) p.(Asp70Glu) - VUS g.66995806C>G - SMAD6(NM_005585.5):c.210C>G (p.D70E) - SMAD6_000106 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
?/. 1 - c.224G>A r.(?) p.(Arg75Gln) - VUS g.66995820G>A g.66703482G>A SMAD6(NM_005585.4):c.224G>A (p.(Arg75Gln)) - SMAD6_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 3 - c.232_250del r.(?) p.(Gln78Glyfs*41) - pathogenic, pathogenic (!) g.66995828_66995846del g.66703490_66703508del SMAD6(NM_005585.4):c.232_250delCAGGGCGCGGGGAGGCGCC (p.(Gln78fs)) - SMAD6_000063 di-genic inheritance, digenic inheritance, VKGL data sharing initiative Nederland PubMed: Timberlake 2016, Journal: Timberlake 2016 - - CLASSIFICATION record, De novo - - - - - Johan den Dunnen, VKGL-NL_Leiden
+?/. 1 - c.238del r.(?) p.(Ala80ArgfsTer45) - likely pathogenic g.66995834del - SMAD6(NM_005585.4):c.238delG (p.A80Rfs*45) - SMAD6_000083 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.251G>T r.(?) p.(Arg84Leu) - VUS g.66995847G>T - SMAD6(NM_005585.5):c.251G>T (p.(Arg84Leu)) - SMAD6_000135 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 2 - c.253C>T r.(?) p.(Arg85Cys) - VUS g.66995849C>T g.66703511C>T SMAD6(NM_005585.4):c.253C>T (p.R85C), SMAD6(NM_005585.5):c.253C>T (p.R85C) - SMAD6_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht
-?/. 1 - c.264C>G r.(?) p.(Gly88=) - likely benign g.66995860C>G g.66703522C>G SMAD6(NM_005585.4):c.264C>G (p.G88=) - SMAD6_000078 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/., +?/. 2 - c.269dup r.(?) p.(Arg91Glufs*30), p.(Arg91GlufsTer30) - likely pathogenic, pathogenic (!) g.66995865dup g.66703527dup 264dup - SMAD6_000049 di-genic inheritance, 2nd variant?, VKGL data sharing initiative Nederland PubMed: Timberlake 2017 - - CLASSIFICATION record, De novo - - - - - Johan den Dunnen, VKGL-NL_Nijmegen
+/. 1 - c.277A>T r.(?) p.(Met93Leu) - pathogenic (!) g.66995873A>T g.66703535A>T - - SMAD6_000064 digenic inheritance PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline/De novo (untested) - - - - - Johan den Dunnen
-?/. 1 - c.290G>A r.(?) p.(Gly97Glu) - likely benign g.66995886G>A - SMAD6(NM_005585.5):c.290G>A (p.G97E) - SMAD6_000131 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.342C>T r.(?) p.(Gly114=) - likely benign g.66995938C>T - SMAD6(NM_005585.4):c.342C>T (p.G114=) - SMAD6_000087 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 1 - c.344G>A r.(?) p.(Trp115Ter) - pathogenic g.66995940G>A g.66703602G>A - - SMAD6_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.352G>T r.(?) p.(Glu118Ter) - VUS g.66995948G>T g.66703610G>T - - SMAD6_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 2 - c.362G>A r.(?) p.(Cys121Tyr) - likely benign g.66995958G>A - SMAD6(NM_005585.5):c.362G>A (p.C121Y) - SMAD6_000097 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht
?/. 1 - c.374C>T r.(?) p.(Thr125Ile) - VUS g.66995970C>T g.66703632C>T SMAD6(NM_005585.4):c.374C>T (p.T125I) - SMAD6_000051 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+/. 2 - c.384_385del r.(?) p.(Ser130Glyfs*172) - pathogenic (!) g.66995980_66995981del g.66703642_66703643del 381_382delTC - SMAD6_000065 di-genic inheritance, digenic inheritance, 2nd variant? PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
?/. 1 - c.395G>T r.(?) p.(Arg132Leu) - VUS g.66995991G>T g.66703653G>T SMAD6(NM_005585.4):c.395G>T (p.R132L) - SMAD6_000052 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.399C>T r.(?) p.(Asp133=) - likely benign g.66995995C>T g.66703657C>T SMAD6(NM_005585.4):c.399C>T (p.D133=) - SMAD6_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.403_423del r.(?) p.(Ala135_Ala141del) - VUS g.66995999_66996019del - SMAD6(NM_005585.4):c.403_423delGCCGGCGCGCCCCGGGACGCC (p.A135_A141del) - SMAD6_000088 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.414C>T r.(?) p.(Pro138=) - likely benign g.66996010C>T - SMAD6(NM_005585.5):c.414C>T (p.P138=) - SMAD6_000103 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-?/. 2 - c.434T>C r.(?) p.(Leu145Pro) - likely benign g.66996030T>C g.66703692T>C SMAD6(NM_005585.4):c.434T>C (p.L145P), SMAD6(NM_005585.5):c.434T>C (p.(Leu145Pro)) - SMAD6_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
+/. 2 - c.465_471del r.(?) p.(Gly156Valfs*23) - pathogenic (!) g.66996061_66996067del g.66703723_66703729del 455_461del - SMAD6_000060 di-genic inheritance, 2nd variant?, suggested di-genic inheritance PubMed: Timberlake 2017, PubMed: Timberlake 2018 - - Germline - - - - - Johan den Dunnen
+/. 1 - c.465_471dup r.(?) p.(Ser158Argfs*147) - pathogenic g.66996061_66996067dup - SMAD6(NM_005585.5):c.465_471dupCGGGCGG (p.S158Rfs*147) - SMAD6_000107 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.505G>C r.(?) p.(Glu169Gln) - likely benign g.66996101G>C - SMAD6(NM_005585.4):c.505G>C (p.(Glu169Gln)) - SMAD6_000118 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.508C>T r.(?) p.(Gln170*) - VUS g.66996104C>T - SMAD6(NM_005585.4):c.508C>T (p.(Gln170*)) - SMAD6_000119 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 1 1 c.521C>T r.(521c>u) p.(Thr174Ile) - VUS g.66996117C>T g.66703779C>T - - SMAD6_000006 - - - - De novo - - - - - Xiaochen Qu
-?/. 1 - c.534G>C r.(?) p.(Ser178=) - likely benign g.66996130G>C - SMAD6(NM_005585.4):c.534G>C (p.S178=) - SMAD6_000089 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.536T>C r.(?) p.(Leu179Pro) - VUS g.66996132T>C g.66703794T>C SMAD6(NM_005585.4):c.536T>C (p.L179P) - SMAD6_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.571C>G r.(?) p.(Leu191Val) - VUS g.66996167C>G - SMAD6(NM_005585.4):c.571C>G (p.L191V) - SMAD6_000084 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.572T>C r.(?) p.(Leu191Pro) - VUS g.66996168T>C g.66703830T>C - - SMAD6_000127 - PubMed: Mansoorshahi 2024 - rs1213841516 Germline - - - - - Johan den Dunnen
-?/. 1 - c.576G>A r.(?) p.(Leu192=) - likely benign g.66996172G>A g.66703834G>A SMAD6(NM_005585.4):c.576G>A (p.L192=) - SMAD6_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.592C>G r.(?) p.(Arg198Gly) - VUS g.66996188C>G g.66703850C>G SMAD6(NM_005585.4):c.592C>G (p.(Arg198Gly)) - SMAD6_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+?/. 1 1 c.596G>A r.(?) p.(Gly199Asp) ACMG likely pathogenic (!) g.66996192G>A g.66703854G>A - - SMAD6_000115 partial genotype-phenotype correlation (abnormality aortic valve), reported as VUS-LP - - rs1427663505 Germline yes - - - - Marketa Wayhelova
+?/. 1 - c.605_606dup r.(?) p.(Gly203ArgfsTer40) - likely pathogenic g.66996201_66996202dup - SMAD6(NM_005585.4):c.605_606dupCG (p.G203Rfs*40) - SMAD6_000085 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
+?/. 1 - c.615C>A r.(?) p.(Cys205*) - likely pathogenic g.66996211C>A - SMAD6(NM_005585.4):c.615C>A (p.(Cys205*)) - SMAD6_000090 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.623T>C r.(?) p.(Val208Ala) - likely benign g.66996219T>C g.66703881T>C SMAD6(NM_005585.4):c.623T>C (p.(Val208Ala)) - SMAD6_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 1 c.632C>G r.(632c>u) p.(Ala211Gly) - VUS g.66996228C>G g.66703890C>G - - SMAD6_000007 - - - - De novo - - - - - Xiaochen Qu
-?/. 1 - c.636C>T r.(?) p.(Asp212=) - likely benign g.66996232C>T g.66703894C>T - - SMAD6_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.652C>T r.(?) p.(Gln218Ter) - likely pathogenic g.66996248C>T g.66703910C>T - - SMAD6_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.653A>T r.(?) p.(Gln218Leu) - VUS g.66996249A>T - SMAD6(NM_005585.4):c.653A>T (p.Q218L) - SMAD6_000098 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/. 1 - c.663G>A r.(?) p.(Pro221=) - likely benign g.66996259G>A g.66703921G>A - - SMAD6_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 3 - c.667C>T r.(?) p.(Gln223*) - pathogenic (!) g.66996263C>T g.66703925C>T - - SMAD6_000066 di-genic inheritance, digenic inheritance PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
?/. 1 - c.683G>C r.(?) p.(Arg228Pro) - VUS g.66996279G>C - SMAD6(NM_005585.4):c.683G>C (p.(Arg228Pro)) - SMAD6_000120 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.690dup r.(?) p.(Arg231Serfs*72) - VUS g.66996286dup - SMAD6(NM_005585.5):c.690dup (p.(Arg231SerfsTer72)) - SMAD6_000113 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
?/. 1 - c.691C>G r.(?) p.(Arg231Gly) - VUS g.66996287C>G - SMAD6(NM_005585.4):c.691C>G (p.R231G) - SMAD6_000094 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.692G>T r.(?) p.(Arg231Leu) - VUS g.66996288G>T g.66703950G>T SMAD6(NM_005585.5):c.692G>T (p.R231L) - SMAD6_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/., -?/. 3 - c.711C>T r.(?) p.(His237=) - benign, likely benign g.66996307C>T g.66703969C>T SMAD6(NM_005585.4):c.711C>T (p.H237=), SMAD6(NM_005585.5):c.711C>T (p.(His237=)) - SMAD6_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
?/. 1 - c.740G>C r.(?) p.(Cys247Ser) - VUS g.66996336G>C - SMAD6(NM_005585.5):c.740G>C (p.C247S) - SMAD6_000114 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.757G>C r.(?) p.(Ala253Pro) - VUS g.66996353G>C g.66704015G>C SMAD6(NM_005585.4):c.757G>C (p.A253P) - SMAD6_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.763G>A r.(?) p.(Asp255Asn) - VUS g.66996359G>A - SMAD6(NM_005585.4):c.763G>A (p.(Asp255Asn)) - SMAD6_000108 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
+/. 2 - c.775del r.(?) p.(Val259CysfsTer280) - pathogenic g.66996371del g.66704033del SMAD6(NM_005585.4):c.775delG (p.V259Cfs*280), SMAD6(NM_005585.5):c.775delG (p.V259Cfs*280) - SMAD6_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
?/. 1 - c.784A>G r.(?) p.(Asn262Asp) - VUS g.66996380A>G - - - SMAD6_000138 - - - rs1270534646 Unknown - - - - - MobiDetails
?/. 1 - c.794del r.(?) p.(His265ProfsTer274) - VUS g.66996390del g.66704052del - - SMAD6_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.802C>T r.(?) p.(Arg268Trp) - VUS g.66996398C>T - SMAD6(NM_005585.5):c.802C>T (p.R268W) - SMAD6_000121 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc
-?/. 1 - c.818-2953T>C r.(=) p.(=) - likely benign g.67001053T>C g.66708715T>C - - SMAD6_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.841C>G r.(?) p.(Arg281Gly) - likely benign g.67004029C>G g.66711691C>G - - SMAD6_000014 2 heterozygous, no homozygous; Clinindb (India) PubMed: Narang 2020, Journal: Narang 2020 - rs200004068 Germline - 2/2795 individuals - - - Mohammed Faruq
-?/. 1 - c.843G>C r.(?) p.(Arg281=) - likely benign g.67004031G>C g.66711693G>C - - SMAD6_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.851C>T r.(?) p.(Pro284Leu) - VUS g.67004039C>T g.66711701C>T - - SMAD6_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.854G>A r.(?) p.(Arg285His) - likely benign g.67004042G>A g.66711704G>A - - SMAD6_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+?/. 1 - c.856G>A r.(?) p.(Asp286Asn) - VUS g.67004044G>A g.66711706G>A - - SMAD6_000128 - PubMed: Mansoorshahi 2024 - rs759918873 Germline - - - - - Johan den Dunnen
+/. 1 - c.859G>A r.(?) p.(Glu287Lys) - pathogenic (!) g.67004047G>A g.66711709G>A - - SMAD6_000067 digenic inheritance PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline/De novo (untested) - - - - - Johan den Dunnen
-?/. 1 - c.875-3C>T r.spl? p.? - likely benign g.67008756C>T - SMAD6(NM_005585.5):c.875-3C>T - SMAD6_000136 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.891A>G r.(?) p.(Thr297=) - likely benign g.67008775A>G g.66716437A>G - - SMAD6_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 2 - c.893dup r.(?) p.(Arg281Serfs*22) - pathogenic (!) g.67008777dup g.66716439dup - - SMAD6_000068 di-genic inheritance, digenic inheritance PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
?/. 1 - c.896del r.(?) p.(Ser299PhefsTer240) - VUS g.67008780del g.66716442del - - SMAD6_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 3 - c.916A>G r.(?) p.(Thr306Ala) - pathogenic (!) g.67008800A>G g.66716462A>G - - SMAD6_000069 di-genic inheritance, digenic inheritance PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
?/. 1 - c.938C>T r.(?) p.(Pro313Leu) - VUS g.67008822C>T - SMAD6(NM_005585.4):c.938C>T (p.P313L) - SMAD6_000086 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.952+24315T>C r.(=) p.(=) - VUS g.67033151T>C g.66740813T>C - - SMAD6_000001 - PubMed: Sebastiani 2008 - rs1440372 Germline - - - - - HbVar - Belinda Giardine and Ross Hardison
-?/., ?/. 2 - c.956C>T r.(?) p.(Ala319Val) - likely benign, VUS g.67073338C>T - SMAD6(NM_005585.4):c.956C>T (p.A319V), SMAD6(NM_005585.5):c.956C>T (p.A319V) - SMAD6_000095 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen
+/. 2 - c.968C>T r.(?) p.(Pro323Leu) - pathogenic (!) g.67073350C>T g.66781012C>T - - SMAD6_000070 di-genic inheritance, digenic inheritance PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
-?/., ?/. 3 - c.973G>A r.(?) p.(Ala325Thr) - likely benign, VUS g.67073355G>A g.66781017G>A SMAD6(NM_005585.5):c.973G>A (p.(Ala325Thr), p.A325T) - SMAD6_000004 VKGL data sharing initiative Nederland HTan direct submission - - CLASSIFICATION record, Germline - - - - - VKGL-NL_Leiden, VKGL-NL_Utrecht, HbVar - Belinda Giardine and Ross Hardison
-?/. 2 - c.998G>C r.(?) p.(Ser333Thr) - likely benign g.67073380G>C g.66781042G>C SMAD6(NM_005585.4):c.998G>C (p.S333T), SMAD6(NM_005585.5):c.998G>C (p.(Ser333Thr)) - SMAD6_000039 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam
-?/. 1 - c.999C>T r.(?) p.(Ser333=) - likely benign g.67073381C>T - SMAD6(NM_005585.4):c.999C>T (p.S333=) - SMAD6_000091 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.1006T>G r.(?) p.(Tyr336Asp) - VUS g.67073388T>G - - - SMAD6_000105 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
+/. 3 - c.1034del r.(?) p.(Arg345Profs*194) - pathogenic (!) g.67073416del g.66781078del 1034delG - SMAD6_000071 di-genic inheritance, digenic inheritance, digenic inheritance, 2nd variant? PubMed: Timberlake 2016, Journal: Timberlake 2016 - - Germline, Germline/De novo (untested) - - - - - Johan den Dunnen
Legend   How to query   « First ‹ Prev     1 2     Next › Last »


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.