All variants in the SMARCA2 gene

Information The variants shown are described using the NM_003070.3 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
?/. - c.687_707del r.(?) p.(Gln232_Gln238del) - VUS g.2039797_2039817del - SMARCA2(NM_003070.4):c.687_707delGCAGCAGCAGCAGCAGCAGCA (p.Q232_Q238del) - SMARCA2_000154 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
Legend   How to query