All variants in the SPRED1 gene

Information The variants shown are described using the NM_152594.2 transcript reference sequence.

1 entry on 1 page. Showing entry 1.
Legend   How to query  

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. - c.345_364del r.(?) p.(Ile116TyrfsTer11) - pathogenic g.38614579_38614598del g.38322378_38322397del SPRED1(NM_152594.2):c.345_364delTATCCGAAGAGCTATAGAGG (p.I116Yfs*11) - SPRED1_000185 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - VKGL-NL_Rotterdam
Legend   How to query