Unique variants in the STARD3 gene

Information The variants shown are described using the NM_001165937.1 transcript reference sequence.

65 entries on 1 page. Showing entries 1 - 65.
Legend   How to query  

Effect     

Reported     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
-?/. 1 - c.1055G>A r.(?) p.(Arg352His) - likely benign g.37817254G>A - STARD3(NM_001165937.1):c.1055G>A (p.(Arg352His)) - STARD3_000020 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*1015C>T r.(=) p.(=) - likely benign g.37820176C>T g.39663923C>T - - STARD3_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*1820A>G r.(=) p.(=) - likely benign g.37820981A>G g.39664728A>G - - STARD3_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.*2009C>T r.(=) p.(=) - VUS g.37821170C>T g.39664917C>T - - STARD3_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*2439A>G r.(=) p.(=) - likely benign g.37821600A>G g.39665347A>G TCAP(NM_003673.4):c.-13A>G - TCAP_000037 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.*2452A>G r.(=) p.(=) - VUS g.37821613A>G - TCAP(NM_003673.3):c.1A>G (p.M1?) - PNMT_000002 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/., -?/. 4 - c.*2483C>T r.(=) p.(=) - benign, likely benign g.37821644C>T g.39665391C>T TCAP(NM_003673.3):c.32C>T (p.S11L), TCAP(NM_003673.4):c.32C>T (p.S11L) - TCAP_000038 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/., ?/. 6 - c.*2488_*2490del r.(=) p.(=) - likely benign, VUS g.37821649_37821651del g.39665396_39665398del 1 more item - TCAP_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
-?/. 1 - c.*2490G>A r.(=) p.(=) - likely benign g.37821651G>A g.39665398G>A TCAP(NM_003673.4):c.39G>A (p.E13=) - TCAP_000040 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.*2503C>T r.(=) p.(=) - VUS g.37821664C>T g.39665411C>T TCAP(NM_003673.3):c.52C>T (p.R18W) - TCAP_000041 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.*2510C>T r.(=) p.(=) - VUS g.37821671C>T g.39665418C>T TCAP(NM_003673.4):c.59C>T (p.A20V) - TCAP_000042 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 6 - c.*2511C>G r.(=) p.(=) - benign, likely benign g.37821672C>G g.39665419C>G TCAP(NM_003673.3):c.60C>G (p.A20=, p.(Ala20=)), TCAP(NM_003673.4):c.60C>G (p.A20=) - TCAP_000043 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
-?/. 1 - c.*2538A>C r.(=) p.(=) - likely benign g.37821699A>C g.39665446A>C - - STARD3_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.*2553C>T r.(=) p.(=) - benign g.37821714C>T - TCAP(NM_003673.4):c.102C>T (p.P34=) - STARD3_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.*2556G>A r.(=) p.(=) - benign g.37821717G>A g.39665464G>A TCAP(NM_003673.4):c.105G>A (p.E35=) - STARD3_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*2571G>C r.(=) p.(=) - likely benign g.37821732G>C g.39665479G>C TCAP(NM_003673.4):c.110+10G>C - TCAP_000044 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
-/. 1 - c.*2576G>C r.(=) p.(=) - benign g.37821737G>C g.39665484G>C TCAP(NM_003673.4):c.110+15G>C - TCAP_000045 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.*2576G>T r.(=) p.(=) - benign g.37821737G>T g.39665484G>T TCAP(NM_003673.4):c.110+15G>T - STARD3_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 1 - c.*2609C>T r.(=) p.(=) - benign g.37821770C>T g.39665517C>T - - TCAP_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/., -?/. 3 - c.*2792C>G r.(=) p.(=) - benign, likely benign g.37821953C>G g.39665700C>G TCAP(NM_003673.3):c.111-16C>G, TCAP(NM_003673.4):c.111-16C>G - TCAP_000046 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-?/., ?/. 3 - c.*2810G>T r.(=) p.(=) - likely benign, VUS g.37821971G>T g.39665718G>T TCAP(NM_003673.3):c.113G>T (p.C38F), TCAP(NM_003673.4):c.113G>T (p.C38F) - TCAP_000067 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
-/. 1 - c.*2829C>T r.(=) p.(=) - benign g.37821990C>T g.39665737C>T TCAP(NM_003673.4):c.132C>T (p.D44=) - TCAP_000047 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.*2845A>G r.(=) p.(=) - VUS g.37822006A>G - TCAP(NM_003673.3):c.148A>G (p.(Thr50Ala)) - STARD3_000018 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden
-?/. 1 - c.*2855A>G r.(=) p.(=) - likely benign g.37822016A>G g.39665763A>G TCAP(NM_003673.3):c.158A>G (p.Q53R) - TCAP_000048 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.*2858A>C r.(=) p.(=) - VUS g.37822019A>C g.39665766A>C TCAP(NM_003673.3):c.161A>C (p.Q54P) - STARD3_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-/. 1 - c.*2883G>A r.(=) p.(=) - benign g.37822044G>A g.39665791G>A TCAP(NM_003673.4):c.186G>A (p.Q62=) - TCAP_000049 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., ?/. 4 - c.*2885G>A r.(=) p.(=) - likely benign, VUS g.37822046G>A g.39665793G>A TCAP(NM_003673.3):c.188G>A (p.R63H), TCAP(NM_003673.4):c.188G>A (p.R63H) - TCAP_000050 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
-/. 3 - c.*2888C>T r.(=) p.(=) - benign g.37822049C>T g.39665796C>T TCAP(NM_003673.3):c.191C>T (p.S64L), TCAP(NM_003673.4):c.191C>T (p.S64L) - TCAP_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 1 - c.*2889G>A r.(=) p.(=) - likely benign g.37822050G>A g.39665797G>A - - STARD3_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*2905C>A r.(=) p.(=) - likely benign g.37822066C>A g.39665813C>A TCAP(NM_003673.3):c.208C>A (p.R70=) - STARD3_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
-?/., ?/. 3 - c.*2905C>T r.(=) p.(=) - likely benign, VUS g.37822066C>T g.39665813C>T TCAP(NM_003673.3):c.208C>T (p.R70W), TCAP(NM_003673.4):c.208C>T (p.R70W) - TCAP_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
?/. 3 - c.*2906G>A r.(=) p.(=) - VUS g.37822067G>A g.39665814G>A TCAP(NM_003673.4):c.209G>A (p.(Arg70Gln), p.R70Q) - TCAP_000053 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Groningen, VKGL-NL_Nijmegen
?/. 2 - c.*2923C>T r.(=) p.(=) - VUS g.37822084C>T g.39665831C>T TCAP(NM_003673.3):c.226C>T (p.R76C), TCAP(NM_003673.4):c.226C>T (p.R76C) - TCAP_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_AMC
+?/. 1 - c.*2950_*2973del r.(=) p.(=) - likely pathogenic g.37822111_37822134del g.39665858_39665881del TCAP(NM_003673.3):c.253_276delTACCAGCGGGTACTGCCGCTGCCC (p.Y85_P92del) - TCAP_000054 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 1 - c.*2957G>A r.(=) p.(=) - VUS g.37822118G>A - TCAP(NM_003673.3):c.260G>A (p.R87Q) - TCAP_000003 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/. 1 - c.*2964G>A r.(=) p.(=) - benign g.37822125G>A g.39665872G>A TCAP(NM_003673.4):c.267G>A (p.L89=) - TCAP_000055 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/., -?/. 2 - c.*2967G>A r.(=) p.(=) - benign, likely benign g.37822128G>A g.39665875G>A TCAP(NM_003673.3):c.270G>A (p.P90=), TCAP(NM_003673.4):c.270G>A (p.P90=) - TCAP_000056 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_AMC
-?/. 1 - c.*2997C>T r.(=) p.(=) - likely benign g.37822158C>T - TCAP(NM_003673.3):c.300C>T (p.G100=) - STARD3_000019 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
?/. 2 - c.*3007G>A r.(=) p.(=) - VUS g.37822168G>A g.39665915G>A TCAP(NM_003673.3):c.310G>A (p.E104K) - STARD3_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Nijmegen
?/. 2 - c.*3010G>A r.(=) p.(=) - VUS g.37822171G>A g.39665918G>A TCAP(NM_003673.4):c.313G>A (p.E105K) - TCAP_000057 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_VUmc, VKGL-NL_AMC
-/., -?/., ?/. 6 - c.*3010G>C r.(=) p.(=) - benign, likely benign, VUS g.37822171G>C g.39665918G>C TCAP(NM_003673.3):c.313G>C (p.E105Q, p.(Glu105Gln)), TCAP(NM_003673.4):c.313G>C (p.E105Q) - TCAP_000069 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
-/., -?/. 5 - c.*3013C>T r.(=) p.(=) - benign, likely benign g.37822174C>T g.39665921C>T TCAP(NM_003673.3):c.316C>T (p.R106C, p.(Arg106Cys)), TCAP(NM_003673.4):c.316C>T (p.R106C) - TCAP_000016 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Leiden, VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_AMC
?/. 1 - c.*3014G>A r.(=) p.(=) - VUS g.37822175G>A - TCAP(NM_003673.4):c.317G>A (p.R106H) - STARD3_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/., ?/. 5 - c.*3034C>T r.(=) p.(=) - likely benign, VUS g.37822195C>T g.39665942C>T TCAP(NM_003673.3):c.337C>T (p.L113F), TCAP(NM_003673.4):c.337C>T (p.L113F) - TCAP_000058 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
?/. 1 - c.*3083A>G r.(=) p.(=) - VUS g.37822244A>G g.39665991A>G - - STARD3_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 2 - c.*3085C>T r.(=) p.(=) - VUS g.37822246C>T g.39665993C>T TCAP(NM_003673.4):c.388C>T (p.R130C) - TCAP_000072 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
?/. 1 - c.*3086G>A r.(=) p.(=) - VUS g.37822247G>A g.39665994G>A TCAP(NM_003673.4):c.389G>A (p.R130H) - TCAP_000059 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
?/. 1 - c.*3118C>G r.(=) p.(=) - VUS g.37822279C>G - TCAP(NM_003673.3):c.421C>G (p.P141A) - TCAP_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht
-/., -?/. 2 - c.*3120C>T r.(=) p.(=) - benign, likely benign g.37822281C>T g.39666028C>T TCAP(NM_003673.4):c.423C>T (p.P141=) - TCAP_000060 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen, VKGL-NL_AMC
?/. 1 - c.*3138C>G r.(=) p.(=) - VUS g.37822299C>G g.39666046C>G TCAP(NM_003673.4):c.441C>G (p.S147R) - STARD3_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.*3139A>C r.(=) p.(=) - VUS g.37822300A>C g.39666047A>C - - STARD3_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.*3145G>A r.(=) p.(=) - VUS g.37822306G>A g.39666053G>A TCAP(NM_003673.4):c.448G>A (p.G150S) - TCAP_000061 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-/. 5 - c.*3150A>C r.(=) p.(=) - benign g.37822311A>C g.39666058A>C TCAP(NM_003673.3):c.453A>C (p.A151=), TCAP(NM_003673.4):c.453A>C (p.A151=) - TCAP_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam, VKGL-NL_Groningen, VKGL-NL_Utrecht, VKGL-NL_Nijmegen, VKGL-NL_AMC
-/. 1 - c.*3153T>C r.(=) p.(=) - benign g.37822314T>C g.39666061T>C TCAP(NM_003673.3):c.456T>C (p.L152=) - TCAP_000062 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 1 - c.*3154C>T r.(=) p.(=) - VUS g.37822315C>T g.39666062C>T TCAP(NM_003673.4):c.457C>T (p.R153C) - TCAP_000063 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 1 - c.*3156T>G r.(=) p.(=) - likely benign g.37822317T>G g.39666064T>G - - STARD3_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
?/. 1 - c.*3158G>A r.(=) p.(=) - VUS g.37822319G>A - TCAP(NM_003673.3):c.461G>A (p.R154H) - STARD3_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Rotterdam
?/. 2 - c.*3169C>T r.(=) p.(=) - VUS g.37822330C>T g.39666077C>T TCAP(NM_003673.4):c.472C>T (p.R158C) - TCAP_000079 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen, VKGL-NL_AMC
+?/. 1 - c.*3171_*3184dup r.(=) p.(=) - likely pathogenic g.37822332_37822345dup g.39666079_39666092dup 1 more item - TCAP_000036 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Groningen
?/. 1 - c.*3181del r.(?) p.(=) - VUS g.37822342del - TCAP(NM_003673.4):c.484delC (p.Q162Rfs*26) - STARD3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_AMC
-?/. 2 - c.*3277G>T r.(=) p.(=) - likely benign g.37822438G>T g.39666185G>T TCAP(NM_003673.3):c.*76G>T - TCAP_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Utrecht, VKGL-NL_Nijmegen
-/. 1 - c.*3279T>G r.(=) p.(=) - benign g.37822440T>G g.39666187T>G - - PGAP3_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*3400G>T r.(=) p.(=) - likely benign g.37822561G>T g.39666308G>T - - TCAP_000015 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-?/. 1 - c.*3578G>C r.(=) p.(=) - likely benign g.37822739G>C g.39666486G>C - - TCAP_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
-/. 1 - c.*3596C>A r.(=) p.(=) - benign g.37822757C>A g.39666504C>A - - PGAP3_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - VKGL-NL_Nijmegen
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.