All variants in the TSC1 gene

The curator’s expert opinion on the classification of a variant, can be found in the
SUMMARY record. Regarding the classification, please note that where there are several
records of the same variant, the classification of that variant may differ depending on the
submitter’s conclusion.
Information The variants shown are described using the NM_000368.4 transcript reference sequence.

1360 entries on 14 pages. Showing entries 1 - 100.
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »

Effect     

Exon     

AscendingDNA change (cDNA)     

RNA change     

Protein     

P-domain     

Predict/SIFT     

Predict/PolyPhen     

Predicted     

Type/DNA     

Predict/Splice     

Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/+ _1_23_ c.-234_*4887{0} r.0? p.0? - - - deletion, large deletion, large - - pathogenic (dominant) g.135663893_135948645del - - - TSC1_001479 284753bp multigene deletion; entire TSC1 deleted (ex 1-23) + 128625bp upstream of TSC1 + 102844bp downstream of TSC1; upstream deletion involves entire GFI1B, GTF3C5, LOC100996574, CEL genes; downstream deletion involves entire SPACA9 and part of AK8 - - - SUMMARY record - - - - - Rosemary Ekong
-/- 20i c.2626-4T[17_21] r.(?) p.(=) - - - - insertion, small - - benign g.135773001A[17-21] - - - TSC1_000175 five alleles of 17-21monomer T runs (18 Ts in reference sequence) - - - SUMMARY record - - - - - Rosemary Ekong
-/- 9i c.914-58T[27_30] r.(?) p.(=) - - - - insertion, small - - benign g.135787013A[27_30] - - - TSC1_000330 microsatellite with base T repeated between 27 to 30 times - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? _1_1i c.[-234-u2538_-234-u2503del(+)-234-u2506_-144+4564delins7] r.0? p.0? - - - - other/complex - - likely pathogenic (dominant) g.? - - - TSC1_000486 36bp del upstream of ex1; another 7161bp del involves ex1 and flanking sequences, plus insertion of 7 unspecified nts. into this region (origin unknown); 45 nts. between the 2 deletions; promoter region reported as -157bp to -744bp completely deleted - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? _1_1i c.[-234-u5895_-144+825del;chr9:g.135822115_135822270inv] r.0? p.0? - - - - other/complex - - likely pathogenic (dominant) g.? - - - TSC1_000485 6811bp deletion; variant includes exon 1, upstream region, and a 156bp inverted sequence upstream of exon 1; promoter region reported between nts. -157bp and -744bp completely deleted - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? _1_1i c.[-234-u9132_-144+317del(+)-234-u9141_-234-u9086inv] r.0? p.0? - - - - other/complex - - likely pathogenic (dominant) g.? - - - TSC1_000484 9540bp deletion; variant includes exon 1, upstream region, and a 56bp inverted sequence upstream of exon 1; promoter region reported between nts. -157bp and -744bp completely deleted - - - SUMMARY record - - - - - Rosemary Ekong
+/+ _1_23_ c.-23076_*17484del r.? p.? - - - - deletion, large - - pathogenic (dominant) g.135754139_135842863del g.132878752_132967476del - - TSC1_000491 88525bp deletion involving the entire TSC1 gene and extending into the3'UTR - - - SUMMARY record - - - - - Rosemary Ekong
-?/-? _1 c.-1055G>T r.(?) p.(=) - - - - substitution - - likely benign g.135820841C>A g.132945454C>A - - TSC1_000630 nt. numbering in the context of TSC1 continues from TSC1 5’UTR (HGVS nomenclature = NG_012386.1:g.4180G>T); variant upstream of TSC1 5’UTR and is within the upstream NTHL1 gene (as NM_002528.5:c.139+669C>A) - - rs1484881165 SUMMARY record - - - - - Rosemary Ekong
-/- _1 c.-1001_-1000delinsAA r.(?) p.(=) - - - - delins - - benign g.135820786_135820787delinsTT g.132945399_132945400delinsTT - - TSC1_000535 2bp deletion of GC and 2bp insertion of AA; common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4234_4235delinsAA - - rs386739091 SUMMARY record - - - - - Rosemary Ekong
-/- _1 c.-945T>G r.(?) p.(=) - - - - substitution - - benign g.135820731A>C g.132945344A>C - - TSC1_000534 common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4290T>G - - rs4962225 SUMMARY record - - MnlI+ - - Rosemary Ekong
-/- _1 c.-822G>A r.(?) p.(=) - - - - substitution - - benign g.135820608C>T g.132945221C>T - - TSC1_000533 common variant in 5' upstream region; HGVS nomenclature = NG_012386.1:g.4413G>A - - rs4962083 SUMMARY record - - MnlI- - - Rosemary Ekong
+?/+? _1_1i c.-589_-144+307del r.0? p.0? - - - - deletion, large - - likely pathogenic (dominant) g.135819624_135820376del g.132944237_132944989del - - TSC1_000487 753bp deletion involving exon 1 and flanking sequences; partial deletion of promoter region, reported between nts. -157bp and -744bp, leaving most 5' 155nts of basal transcription core still present; expression of this deletion not analysed - - - SUMMARY record - - - - - Rosemary Ekong
-?/-? _1 c.-438T>G r.(?) p.(=) - - - - substitution - - likely benign g.135820224A>C g.132944837A>C - - TSC1_000527 variant is upstream of TSC1; HGVS compliant description = NG_012386.1:g.4797T>G (TSC1) - - rs1041499541 SUMMARY record - - HpyAV- - - Rosemary Ekong
?/? _1_1i c.-295_-144+105del{0} r.0? p.0? - - - - deletion, large - - VUS g.135819825_135820081del g.132944438_132944694del - - TSC1_001437 exon 1 deleted; the deletion partially removes the promoter region which is reported between nts. -157bp and -744bp; effect on TSC1 expression unknown - - - SUMMARY record - - - - - Rosemary Ekong
-/- _1 c.-278dup r.(?) p.(=) - - - - duplication - - benign g.135820068dup g.132944681dup - - TSC1_000532 1bp duplication of G upstream of exon 1; HGVS nomenclature = NG_012386.1:g.4957dup (TSC1) or NG_034227.1:g.4137dupC (GFI1B) - - rs544305928 SUMMARY record - - BslI+ - - Rosemary Ekong
?/? _1_1i c.(?_-234)_(-144+1_-143-1)del r.0? p.0? - - - - deletion, large - - VUS g.(135810483_135819929)_(135820020_?)del - - - TSC1_000512 MLPA probe for exon 1 (GAGGGACTGTGA-GGTAAACAGCTG) is at c.-185_-162; promoter region reported between nts. -157bp and -744bp starts in exon 1 and is probably partially deleted, at least. Extent of the deletion and effect on gene expression not determined. - - - SUMMARY record - - - - - Rosemary Ekong
?/? _1_1i c.(?_-234)_(-144+1_-143-1)dup r.0? p.0? - - - - duplication, large - - VUS g.(135810483_135819929)_(135820020_?)dup - - - TSC1_000713 TSC1 exon 1 duplicated and breakpoints undetermined; partial duplication of promoter region, reported between nts. -157bp and -744bp (i.e. -157_-u510) - - - SUMMARY record - - - - - Rosemary Ekong
+/+ _1_8i c.(?_-234)_(737+1_738-1)del r.0? p.0? - - - - deletion, large - - pathogenic (dominant) g.(135787845_135796749)_(135820020_?)del - - - TSC1_000908 exons 1-8 deleted - - - SUMMARY record - - - - - Rosemary Ekong
+/+ _1_14i c.(?_-234)_(1438+1_1439-1)del r.0? p.0? - - - - deletion, large - - pathogenic (dominant) g.(135781527_135782117)_(135820020_?)del - - - TSC1_000801 exons 1-14 deleted - - - SUMMARY record - - - - - Rosemary Ekong
+/+ _1_23_ c.(?_-234)_(*4887_?)del r.0? p.0? - - - - deletion, large - - pathogenic (dominant) g.(?_135766735)_(135820020_?)del - - - TSC1_000170 exons 1-23 deleted - - - SUMMARY record - - - - - Rosemary Ekong
?/? _1 c.(?_-234)_?del(147000) r.0? p.0? - - - deletion, large deletion, large - - VUS g.(?_135766735)_?del(147000) g.(?_132891348)_?del(147000) - - TSC1_001345 147kb deletion involving part of TSC1, GF11B and GTF3C5 (both genes at 5’ of TSC1); deletedTSC1 exons not mentioned and extent of deletion into TSC1 undetermined - - - SUMMARY record - - - - - Rosemary Ekong
?/? 1 c.-227G>A r.(?) p.? - - - - substitution unlikely to affect splicing - VUS g.135820013C>T g.132944626C>T - - TSC1_001233 - - - rs886063629 SUMMARY record - - BseRI+ - - Rosemary Ekong
?/? 1_1i c.-219_-144+3del r.0? p.0? - - - - deletion, large - - VUS g.135819931_135820009del g.132944544_132944622del - - TSC1_001471 79bp deletion extends from exon 1 to intron 1; deletion extends into the promoter region which starts in exon 1 and is reported to be between nts. -157bp and -744bp; promoter region partially deleted. Effect on gene expression not determined. - - - SUMMARY record - - AluI-, BanI- - - Rosemary Ekong
?/? 1 c.-159G>A r.(?) p.(=) - - - - substitution unlikely to affect splicing - VUS g.135819945C>T g.132944558C>T - - TSC1_001333 - - - - SUMMARY record - - BbvCI-, Bpu10I- - - Rosemary Ekong
?/? 1i c.-144+7A>T r.(?) p.(=) - - - - substitution unlikely to affect splicing - VUS g.135819923T>A g.132944536T>A - - TSC1_001315 - - - rs563924788 SUMMARY record - - - - - Rosemary Ekong
-?/-? 1i c.-144+1475A>G r.(?) p.(=) - - - - substitution - - likely benign g.135818455T>C g.132943068T>C - - TSC1_000529 - - - - SUMMARY record - - Hpy188III- - - Rosemary Ekong
-?/-? 1i c.-144+1530T>G r.(?) p.(=) - - - - substitution - - likely benign g.135818400A>C g.132943013A>C - - TSC1_000530 - - - rs989297207 SUMMARY record - 1/31398 alleles BsaJI+, BstNI+ - - Rosemary Ekong
+/+ 1i_23_ c.-144+3172_*67438del r.? p.? - - - - deletion, large - - pathogenic (dominant) g.135704184_135816758del g.132828797_132941371del - - TSC1_000488 112575bp deletion starting in intron 1 and including exons 2-23 and 3'UTR - - - SUMMARY record - - - - - Rosemary Ekong
+/+ _1_5i c.(?_-143-1)_(363+1_364-1)del r.? p.? - - - deletion, large deletion, large - - pathogenic g.(135798880_135800973)_(135810483_?)del - - - TSC1_001466 exons 1-5 deleted; 5' end of deletion not determined - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 1i_23_ c.(-144+1_-143-1)_(*4887_?)del r.? p.? - - - - deletion, large - - pathogenic (dominant) g.(?_135766735)_(135810483_135819929)del - - - TSC1_000716 exons 2-23 deleted - - - SUMMARY record - - - - - Rosemary Ekong
-?/-? 2 c.-131del r.(?) p.? - - - - deletion unlikely to affect splicing - likely benign g.135810470del g.132935083del - - TSC1_001232 1bp deletion of A - - - SUMMARY record - - - - - Rosemary Ekong
-/- 2 c.-129A>T r.(?) p.(=) - - - - substitution - - benign g.135810468T>A g.132935081T>A - - TSC1_000239 - - - rs116951280 SUMMARY record - 419/43980 alleles, 1 homozygotes - - - Rosemary Ekong
-/- 2i c.-80-396A>G r.(?) p.(=) - - - - substitution - - benign g.135804735T>C g.132929348T>C - - TSC1_000537 common variant in intron 2 - - rs3761840 SUMMARY record - 18687/43822 alleles, 2858 homozygotes - - - Rosemary Ekong
-/- 2i c.-80-55T>C r.(?) p.(=) - - - - substitution - - benign g.135804394A>G g.132929007A>G - - TSC1_000942 variant in intron 2 - - rs547649950 SUMMARY record - 4/36404 alleles - - - Rosemary Ekong
?/? 2i c.-80-51del r.(?) p.(=) - - - - deletion - - VUS g.135804396del g.132929009del - - TSC1_000608 5'UTR variant; 1bp deletion of T; deleted base is in bracket and CAPITAL - cttgcaggtattttctttttt(T)atggagaaaaatggggccatttag - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? 2i_8i c.(-81+1_-80-1)_(737+1_738-1)del r.? p.? - - - - deletion, large - - likely pathogenic (dominant) g.(135787845_135796749)_(135804340_135810419)del - - - TSC1_000782 exons 3-8 deleted - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 2i_14i c.(-81+1_-80-1)_(1438+1_1439-1)del r.(?) p.? - - - deletion, large deletion, large - - pathogenic (dominant) g.(135804340_135810419)_(135781527_135782117)del g.(132928953_132935032)_(132906140_132906730)del - - TSC1_001346 exons 3-14 deleted - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 2i_23_ c.(-81+1_-80-1)_(*4887_?)del r.? p.? - - - - deletion, large - - pathogenic (dominant) g.(?_135766735)_(135804340_135810419)del - - - TSC1_000718 TSC1 3-23 deleted - - - SUMMARY record - - - - - Rosemary Ekong
?/? 3 c.-44G>A r.(?) p.(=) - - - - substitution - - VUS g.135804303C>T g.132928916C>T - - TSC1_000541 - - - rs773447503 SUMMARY record - 7/249052 alleles - - - Rosemary Ekong
-/- 3 c.-16G>A r.(?) p.(=) - - - - substitution - - benign g.135804275C>T g.132928888C>T - - TSC1_000538 - - - rs114970627 SUMMARY record - 18/282996 alleles - - - Rosemary Ekong
-/- 3 c.-7C>T r.(?) p.(=) - - - - substitution - - benign g.135804266G>A g.132928879G>A - - TSC1_000240 - - - rs62621221 SUMMARY record - 364/308640 alleles, 2 homozygotes - - - Rosemary Ekong
+/+ 12i_23_ c.(1263+1_1264-1)_*4887{0} r.? p.? - - - deletion, large deletion, large - - pathogenic (dominant) g.(135782758_135785957)_(135766735_?)del g.(132907371_132910570)_(132891348_?)del - - TSC1_001414 exons 13-23 deleted - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 3 c.17del r.(?) p.(Asn6Metfs*20) - - - frameshift deletion - - pathogenic g.135804245del g.132928858del - - TSC1_000539 1bp deletion of A - - - SUMMARY record - - BsrDI+ - - Rosemary Ekong
-?/-? 3 c.21C>T r.(?) p.(Val7=) - - - - substitution - - likely benign g.135804239G>A g.132928852G>A - - TSC1_000540 - - - rs145987906 SUMMARY record - 4/282792 alleles - - - Rosemary Ekong
?/? 3 c.39G>T r.(?) p.(Met13Ile) - - possibly damaging missense substitution - - VUS g.135804221C>A g.132928834C>A - - TSC1_001372 - - - - SUMMARY record - - Hpy188III+ - - Rosemary Ekong
+?/+? 3 c.52_55del r.(?) p.(Met18Trpfs*7) - - - - deletion, small - - likely pathogenic (dominant) g.135804206_135804209del g.132928819_132928822del - - TSC1_000977 4bp deletion of ATGC - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 3 c.62_63insTG r.(?) p.(Arg22Glyfs*5) - - - - insertion, small - - pathogenic (dominant) g.135804197_135804198insCA g.132928810_132928811insCA - - TSC1_000967 - - - - SUMMARY record - - - - - Rosemary Ekong
?/? 3 c.64C>T r.(?) p.(Arg22Trp) - - probably damaging missense substitution - - VUS g.135804196G>A g.132928809G>A - - TSC1_001373 - - - rs749030456 SUMMARY record - 4/251306 alleles AciI-, MwoI- - - Rosemary Ekong
?/? 3 c.65G>A r.(?) p.(Arg22Gln) - - - missense substitution - - VUS g.135804195C>T g.132928808C>T - - TSC1_000954 - - - rs141736779 SUMMARY record - 7/295750 alleles - - - Rosemary Ekong
+/+ 3 c.68del r.(?) p.(Asp23Alafs*3) - - - frameshift deletion - - pathogenic (dominant) g.135804192del g.132928805del - - TSC1_001314 1bp deletion of A - - - SUMMARY record - - Cac8I+, BsmFI- - - Rosemary Ekong
+/+ 3 c.70del r.(?) p.(Asp24Thrfs*2) - - - - deletion - - pathogenic (dominant) g.135804190del g.132928803del - - TSC1_000198 1bp deletion of G - - - SUMMARY record - - - - - Rosemary Ekong
?/? 3 c.70G>A r.(?) p.(Asp24Asn) - - benign missense substitution unlikely to affect splicing - VUS g.135804190C>T g.132928803C>T - - TSC1_001439 - - - rs984306144 SUMMARY record - 1/31408 alleles BmgBI-, Hpy99I- - - Rosemary Ekong
-?/-? 3 c.73G>A r.(?) p.(Val25Met) - - - - substitution - - likely benign g.135804187C>T g.132928800C>T - - TSC1_000946 - - - rs1230244328 SUMMARY record - 7/143308 alleles - - - Rosemary Ekong
+/+ 3 c.75del r.(?) p.(Thr26Glnfs*17) - - - - deletion - - pathogenic (dominant) g.135804185del g.132928798del - - TSC1_001284 - - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 3 c.85_90delinsC r.(?) p.(Phe29Argfs*6) - - - frameshift delins - - pathogenic (dominant) g.135804170_135804175delinsG g.132928783_132928788delinsG - - TSC1_001229 6bp deletion of TTTAAA and 1bp insertion of C - - - SUMMARY record - - Hpy188I+, DraI- - - Rosemary Ekong
+/+ 3 c.87del r.(?) p.(Phe29Leufs*14) - - - frameshift deletion - - pathogenic g.135804175del g.132928788del - - TSC1_000542 1bp deletion of T - - - SUMMARY record - - DraI- - - Rosemary Ekong
-/- 3 c.89A>G r.(?) p.(Lys30Arg) - - benign missense substitution - - benign g.135804171T>C g.132928784T>C - - TSC1_000909 - - - rs796053452 SUMMARY record - 3/143324 alleles DraI-, MseI- - - Rosemary Ekong
+/+ 3 c.89_102del r.(?) p.(Lys30Ilefs*2) - - - frameshift deletion, small - - pathogenic (dominant) g.135804158_135804171del g.132928771_132928784del - - TSC1_001334 14bp deletion of AAGAGAACCTCAAT - - - SUMMARY record - - DraI-, MnlI- - - Rosemary Ekong
+/+ 3 c.90del r.(?) p.(Glu31Argfs*12) - - - - deletion - - pathogenic (dominant) g.135804172del g.132928785del - - TSC1_000966 1bp deletion of A - - - SUMMARY record - - - - - Rosemary Ekong
-?/-? 3 c.101A>G r.(?) p.(Asn34Ser) - - benign missense substitution - - likely benign g.135804159T>C g.132928772T>C - - TSC1_001513 reported that variant did not disrupt TSC2 function in vitro - - - SUMMARY record - - DdeI+, MluCI- - - Mark Nellist
-/- 3i c.106+15A>G r.(?) p.(=) - - - - substitution - - benign g.135804139T>C g.132928752T>C - - TSC1_000001 - - - rs80258442 SUMMARY record - 1529/300256 alleles, 44 homozygotes - - - Rosemary Ekong
-/- 3i c.106+47A>C r.(?) p.(=) - - - - substitution unlikely to affect splicing - benign g.135804107T>G g.132928720T>G - - TSC1_000645 - - - rs373390352 SUMMARY record - 43/296682 alleles - - - Rosemary Ekong
+/+ 3i c.107-2A>G r.spl p.? - - - - substitution affects splicing - pathogenic (dominant) g.135802693T>C g.132927306T>C - - TSC1_000002 acceptor splice site affected - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 3i c.107-1G>A r.spl p.? - - - - substitution affects splicing - pathogenic (dominant) g.135802692C>T g.132927305C>T - - TSC1_000528 EDIT FROM HERE UP - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.107_113dup r.(?) p.(Met40Trpfs*32) - - - frameshift duplication, small - - pathogenic (dominant) g.135802685_135802691dup - - - TSC1_001421 7bp duplication of ACCGTGG - - - SUMMARY record - - AvaII+ - - Rosemary Ekong
+/+ 4 c.109dup r.(?) p.(Arg37Profs*33) - - - - duplication - - pathogenic (dominant) g.135802690dup g.132927303dup - - TSC1_000241 1bp duplication of C - - - SUMMARY record - - - - - Rosemary Ekong
-?/-? 4 c.110G>A r.(?) p.(Arg37His) - - probably damaging missense substitution - - likely benign g.135802688C>T g.132927301C>T - - TSC1_001511 reported that variant did not disrupt TSC2 function in vitro - - rs750441497 SUMMARY record - 5/250588 alleles FatI+, HpyCH4III- - - Mark Nellist
-?/-? 4 c.110G>C r.(?) p.(Arg37Pro) - - probably damaging missense substitution - - likely benign g.135802688C>G g.132927301C>G - - TSC1_001512 reported that variant did not disrupt TSC2 function in vitro - - - SUMMARY record - - StyD4I+, BtgI- - - Mark Nellist
+/+ 4 c.111dup r.(?) p.(Gly38Trpfs*32) - - - frameshift duplication - - pathogenic g.135802687dup g.132927300dup - - TSC1_001227 1bp duplication of T - - - SUMMARY record - - BtgI- - - Rosemary Ekong
+/+ 4 c.120dup r.(?) p.(Leu41Alafs*29) - - - frameshift duplication - - pathogenic g.135802678dup g.132927291dup - - TSC1_000543 1bp duplication of G - - - SUMMARY record - - - - - Rosemary Ekong
-?/-? 4 c.121C>A r.(?) p.(Leu41Ile) - - - - substitution - - likely benign g.135802677G>T g.132927290G>T - - TSC1_000003 - - - - SUMMARY record - - - - - Rosemary Ekong
-/- 4 c.126A>C r.(?) p.(Val42=) - - - - substitution - - benign g.135802672T>G g.132927285T>G - - TSC1_000391 - - - rs118203335 SUMMARY record - 19/287604 alleles - - - Rosemary Ekong
+/+ 4 c.127_128del r.(?) p.(Asn43Hisfs*26) - - - frameshift deletion, small - - pathogenic (dominant) g.135802670_135802671del - - - TSC1_001422 2bp deletion of AA - - - SUMMARY record - - BsrGI+, CviQI+ - - Rosemary Ekong
+/+ 4 c.127_128dup r.(?) p.(Asn43Lysfs*20) - - - frameshift duplication, small - - pathogenic (dominant) g.135802671_135802672dup g.132927284_132927285dup - - TSC1_001370 2bp duplication of AA - - - SUMMARY record - - Hpy166II- - - Rosemary Ekong
+/+ 4 c.128_145delinsTC r.(?) p.(Asn43Ilefs*14) - - - frameshift delins - - pathogenic g.135802653_135802670delinsGA g.132927266_132927283delinsGA - - TSC1_001469 18bp deletion of ACACCTTGGTGGATTATT and 2bp insertion of TC - - - SUMMARY record - - HphI+, AleI- - - Rosemary Ekong
+/+ 4 c.129del r.(?) p.(Asn43Lysfs*19) - - - frameshift deletion - - pathogenic g.135802669del g.132927282del - - TSC1_001226 1bp deletion of C - - - SUMMARY record - - AleI-, MslI- - - Rosemary Ekong
+/+ 4 c.130dup r.(?) p.(Thr44Asnfs*26) - - - - duplication - - pathogenic (dominant) g.135802668dup g.132927281dup - - TSC1_000392 1bp duplication of A - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.131_132dup r.(?) p.(Leu45Profs*18) - - - - duplication, small - - pathogenic (dominant) g.135802666_135802667dup g.132927279_132927280dup - - TSC1_000378 2bp duplication of CC - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? 4 c.132dup r.(?) p.(Val46Glyfs*24) - - - - duplication - - likely pathogenic (dominant) g.135802667dup g.132927280dup - - TSC1_000309 1bp duplication of C - - - SUMMARY record - - - - - Rosemary Ekong
?/? 4 c.135G>A r.(?) p.(Leu45=) - - - silent substitution unlikely to affect splicing - VUS g.135802663C>T g.132927276C>T - - TSC1_001326 - - - rs149278759 SUMMARY record - 4/264282 alleles DdeI+, BsaJI- - - Rosemary Ekong
+/+ 4 c.136del r.(?) p.(Val46Trpfs*16) - - - - deletion - - pathogenic (dominant) g.135802663del g.132927276del - - TSC1_000808 1bp deletion of G - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.144T>A r.(?) p.(Tyr48*) - - - nonsense substitution - - pathogenic g.135802654A>T g.132927267A>T - - TSC1_001225 - - - - SUMMARY record - - AseI+, MseI+ - - Rosemary Ekong
+/+ 4 c.145del r.(?) p.(Tyr49Thrfs*13) - - - - deletion - - pathogenic (dominant) g.135802654del g.132927267del - - TSC1_000004 1bp deletion of T - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.146del r.(?) p.(Tyr49Serfs*13) - - - - deletion - - pathogenic (dominant) g.135802652del g.132927265del - - TSC1_000649 1bp deletion of A - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.147C>A r.(?) p.(Tyr49*) - - - nonsense substitution - - pathogenic (dominant) g.135802651G>T g.132927264G>T - - TSC1_001390 - - - - SUMMARY record - - MseI+, BstNI- - - Rosemary Ekong
+/+ 4 c.148del r.(?) p.(Leu50Trpfs*12) - - - - deletion - - pathogenic (dominant) g.135802651del g.132927264del - - TSC1_000310 1bp deletion of C - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.149del r.(?) p.(Leu50Argfs*12) - - - frameshift deletion - - pathogenic g.135802649del g.132927262del - - TSC1_001223 1bp deletion of T - - - SUMMARY record - - BsaWI+, PspGI- - - Rosemary Ekong
+?/+? 4 c.149T>C r.(?) p.(Leu50Pro) - - probably damaging missense substitution - - likely pathogenic (dominant) g.135802649A>G g.132927262A>G - - TSC1_000005 - - - - SUMMARY record - - NciI+, BstNI- - - Rosemary Ekong
-/- 4 c.153A>C r.(?) p.(Glu51Asp) - - - missense substitution - - benign g.135802645T>G g.132927258T>G - - TSC1_000006 - - - rs118203342 SUMMARY record - 1/251354 alleles - - - Rosemary Ekong
+/+ 4 c.160dup r.(?) p.(Ser54Phefs*16) - - - frameshift duplication - - pathogenic (dominant) g.135802638dup g.132927251dup - - TSC1_001220 1bp duplication of T - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.163C>T r.(?) p.(Gln55*) - - - - substitution - - pathogenic (dominant) g.135802635G>A g.132927248G>A - - TSC1_000311 - - - - SUMMARY record - - - - - Rosemary Ekong
+/+ 4 c.170dup r.(?) p.(Leu58Ilefs*12) - - - frameshift duplication - - pathogenic g.135802628dup g.132927241dup - - TSC1_000793 1bp duplication of C - - - SUMMARY record - - HaeIII+, MwoI- - - Rosemary Ekong
+/+ 4 c.178del r.(?) p.(Ile60Serfs*2) - - - - deletion - - pathogenic (dominant) g.135802620del g.132927233del - - TSC1_000809 1bp deletion of A - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? 4 c.181_189del r.(?) p.(Leu61_Thr63del) - - - - deletion, small - - likely pathogenic (dominant) g.135802610_135802618del g.132927223_132927231del - - TSC1_000312 9bp (in-frame) deletion of CTGACCACC - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? 4 c.182T>C r.(?) p.(Leu61Pro) - - - - substitution - - likely pathogenic (dominant) g.135802616A>G g.132927229A>G - - TSC1_000007 - - - - SUMMARY record - - - - - Rosemary Ekong
+?/+? 4 c.182T>G r.(?) p.(Leu61Arg) - - - - substitution - - likely pathogenic (dominant) g.135802616A>C g.132927229A>C - - TSC1_000494 - - - - SUMMARY record - - - - - Rosemary Ekong
?/? 4 c.184A>G r.(?) p.(Thr62Ala) - - benign missense substitution unlikely to affect splicing - VUS g.135802614T>C g.132927227T>C - - TSC1_001563 - - - - SUMMARY record - - BstNI+, Hpy188III- - - Rosemary Ekong
?/? 4 c.190T>G r.(?) p.(Leu64Val) - - benign missense substitution - - VUS g.135802608A>C g.132927221A>C - - TSC1_001510 reported that variant has possible effect on the TSC complex but effectively inhibits TORC1 - - - SUMMARY record - - HpyCH4III+ - - Mark Nellist
+?/+? 4 c.191T>G r.(?) p.(Leu64Trp) - - probably damaging missense substitution - - likely pathogenic (dominant) g.135802607A>C g.132927220A>C - - TSC1_000965 - - - - SUMMARY record - - BstNI+, PspGI+ - - Rosemary Ekong
+/+ 4 c.191_196del r.(?) p.(Leu64*) - - - - deletion, small - - pathogenic (dominant) g.135802602_135802607del g.132927215_132927220del - - TSC1_000810 6bp deletion of TGCAAG - - - SUMMARY record - - - - - Rosemary Ekong
Legend   How to query   « First ‹ Prev     1 2 3 4 5 6 7 8 9 10 11 ...     Next › Last »

Assessment of functional consequences - Our conclusions on the functional consequences of variants are based on the type of variant, results of in vitro functional tests (doi: 10.1002/humu.21451; doi: 10.1002/humu.22202; doi: 10.1002/humu.23963), population frequencies, output from in silico splice site prediction algorithms, and any clinical/family data available to us. We also have output from protein prediction programs in this database for comparison purposes and they are not considered in our assessment of pathogenicity. PolyPhen Predictions - Note that these results are from PolyPhen-2 and only the HumDiv classification is shown.