All variants

8 entries on 1 page. Showing entries 1 - 8.
Legend   How to query  

Effect     

Chr     

Classification method     

Clinical classification     

AscendingDNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     

ISCN     

DB-ID     

Variant remarks     

Reference     

ClinVar ID     

dbSNP ID     

Origin     

Segregation     

Frequency     

Re-site     

VIP     

Methylation     

Owner     
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
+/. X - pathogenic (recessive) g.139502961_139502962ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] g.140420796_140420797ins[NC_000009.12:g.147651_205370;CGGGCGTAGTGGCGGGCGCCTGTAGCTATATCTAGCT] - - chrX_019795 RNA analysis shows upregulation downstream long non-coding RNA LINC00632, and downregulation circular RNA CDR1as/ciRS-7 (circular RNA sponge for miR-7) spliced from linear LINC00632 PubMed: Gardner 2025 - - Germline yes - - - - Johan den Dunnen
Legend   How to query  


Screenscraping/webscraping (downloading large amounts of data using scripts) is strictly prohibited.
Use our APIs to retrieve data.