Full data view for gene AMOT

Information The variants shown are described using the NM_133265.2 transcript reference sequence.

32 entries on 1 page. Showing entries 1 - 32.
Legend   How to query  



AscendingDNA change (cDNA)     

RNA change     



Classification method     

Clinical classification     

DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     



















Age at death     




Panel size     

?/. - c.? r.(?) p.(Arg534Lys) Unknown - VUS g.? - - - USP9X_000005 - PubMed: Heidet 2017 - - Germline - - - 0 - DNA SEQ, SEQ-NG - 330-gene panel CAKUT K84 PubMed: Heidet 2017 fetus - - France - - 0 - - 1 Johan den Dunnen
?/. - c.-356+7257_-356+7258del r.(=) p.(=) Unknown - VUS g.112068284_112068285del g.112825056_112825057del - - AMOT_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.-355-7184G>A r.(=) p.(=) Unknown - likely benign g.112066289C>T - AMOT(NM_001113490.1):c.66G>A (p.Q22=) - AMOT_000035 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-355-6814C>G r.(=) p.(=) Unknown - likely benign g.112065919G>C g.112822691G>C AMOT(NM_001113490.1):c.436C>G (p.R146G) - AMOT_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-347A>C r.(?) p.(=) Unknown - VUS g.112059097T>G g.112815869T>G AMOT(NM_001113490.1):c.881A>C (p.(Gln294Pro)) - AMOT_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.-173C>T r.(?) p.(=) Unknown - likely benign g.112058923G>A - AMOT(NM_001113490.1):c.1055C>T (p.P352L) - AMOT_000033 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-125G>A r.(?) p.(=) Unknown - likely benign g.112058875C>T g.112815647C>T AMOT(NM_001113490.1):c.1103G>A (p.(Arg368His)), AMOT(NM_001113490.2):c.1103G>A (p.R368H) - AMOT_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-125G>A r.(?) p.(=) Unknown - likely benign g.112058875C>T - AMOT(NM_001113490.1):c.1103G>A (p.(Arg368His)), AMOT(NM_001113490.2):c.1103G>A (p.R368H) - AMOT_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-35_-33dup r.(?) p.(=) Unknown - VUS g.112058796_112058798dup g.112815568_112815570dup AMOT(NM_001113490.1):c.1195_1196insAGC (p.(Gln398dup)) - AMOT_000012 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.-34G>A r.(?) p.(=) Unknown - likely benign g.112058784C>T - AMOT(NM_001113490.1):c.1194G>A (p.Q398=) - AMOT_000034 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.15G>A r.(=) p.(=) Parent #1 - VUS g.112058736C>T g.112815508C>T Q5Q - AMOT_000020 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - 4/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 4 Lucy Raymond
+?/. 7 c.699G>C r.spl? p.(Gln233His) Unknown - likely pathogenic g.112035060C>G g.112791832C>G NM_001113490.1:c.1926G>C - AMOT_000003 - PubMed: Bosch 2016, Journal: Bosch 2016 - - De novo - - - 0 - DNA SEQ-NG - - CVI, ID - PubMed: Bosch 2016, Journal: Bosch 2016 - F no Netherlands - - 0 - - 1 Danielle Bosch
?/. - c.726C>T r.(=) p.(=) Parent #1 - VUS g.112033984G>A g.112790756G>A N242N - AMOT_000019 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
?/. - c.1121G>A r.(?) p.(Arg374Gln) Unknown - VUS g.112024239C>T g.112781011C>T AMOT(NM_001113490.1):c.2348G>A (p.R783Q) - AMOT_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1203C>A r.(=) p.(=) Parent #1 - VUS g.112024157G>T g.112780929G>T I401I - AMOT_000018 recurrent, found 18 times PubMed: Tarpey 2009 - - Germline - 18/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 18 Lucy Raymond
?/. - c.1229G>A r.(?) p.(Ser410Asn) Unknown - VUS g.112024131C>T g.112780903C>T AMOT(NM_001113490.1):c.2456G>A (p.S819N) - AMOT_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1247-169C>T r.(=) p.(=) Maternal (inferred) - VUS g.112023077G>A g.112779849G>A - - AMOT_000002 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1261G>A r.(?) p.(Gly421Arg) Parent #1 - VUS g.112022894C>T g.112779666C>T - - AMOT_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
?/. - c.1271G>A r.(?) p.(Arg424His) Unknown - VUS g.112022884C>T g.112779656C>T AMOT(NM_001113490.1):c.2498G>A (p.R833H) - AMOT_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1382C>T r.(?) p.(Thr461Met) Unknown - likely benign g.112022773G>A g.112779545G>A AMOT(NM_001113490.1):c.2609C>T (p.T870M) - AMOT_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1438G>A r.(?) p.(Ala480Thr) Unknown - VUS g.112022717C>T g.112779489C>T AMOT(NM_001113490.1):c.2665G>A (p.A889T) - AMOT_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1452_1466dup r.(?) p.(Ala485_Ala489dup) Unknown - likely benign g.112022695_112022709dup g.112779467_112779481dup AMOT(NM_001113490.1):c.2693_2694insTGCCGCCATCACTGC (p.(Ala894_Ala898dup)) - AMOT_000031 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1511_1537del r.(?) p.(Val504_Pro512del) Unknown - VUS g.112022631_112022657del g.112779403_112779429del AMOT(NM_001113490.1):c.2738_2764del (p.(Val913_Pro921del)) - AMOT_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1511_1537del r.(?) p.(Val504_Pro512del) Unknown - VUS g.112022631_112022657del g.112779403_112779429del 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
?/. - c.1568C>T r.(?) p.(Ala523Val) Unknown - VUS g.112022587G>A g.112779359G>A AMOT(NM_001113490.1):c.2795C>T (p.A932V) - AMOT_000030 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1576A>G r.(?) p.(Thr526Ala) Parent #1 - VUS g.112022579T>C g.112779351T>C - - AMOT_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
?/. - c.1625C>T r.(?) p.(Ala542Val) Unknown - VUS g.112022530G>A g.112779302G>A AMOT(NM_001113490.1):c.2852C>T (p.A951V, p.(Ala951Val)) - AMOT_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1625C>T r.(?) p.(Ala542Val) Unknown - likely benign g.112022530G>A g.112779302G>A AMOT(NM_001113490.1):c.2852C>T (p.A951V, p.(Ala951Val)) - AMOT_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1706_1723del r.(?) p.(Pro569_Ala574del) Unknown - likely benign g.112022442_112022459del g.112779214_112779231del AMOT(NM_001113490.1):c.2933_2950del (p.(Pro978_Ala983del)) - AMOT_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1817C>T r.(?) p.(Ala606Val) Unknown - likely benign g.112022338G>A g.112779110G>A AMOT(NM_001113490.1):c.3044C>T (p.A1015V) - AMOT_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1855_1857dup r.(?) p.(Pro619dup) Parent #1 - VUS g.112022299_112022301dup g.112779071_112779073dup 1857_1858insCCT;K619_A620insP - AMOT_000015 recurrent, found 5 times PubMed: Tarpey 2009 - - Germline - 5/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 5 Lucy Raymond
-?/. - c.1872C>T r.(?) p.(Thr624=) Unknown - likely benign g.112022283G>A - AMOT(NM_001113490.1):c.3099C>T (p.T1033=) - AMOT_000032 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
Legend   How to query