Full data view for gene AMOT

Information The variants shown are described using the NM_133265.2 transcript reference sequence.

31 entries on 1 page. Showing entries 1 - 31.



AscendingDNA change (cDNA)     


RNA change     



DNA change (genomic) (hg19)     

DNA change (hg38)     

Published as     



Variant remarks     


ClinVar ID     

dbSNP ID     























Panel size     

?/. - c.-356+7237_-356+7238del - - p.(=) Unknown g.112068284_112068285del g.112825056_112825057del - - AMOT_000001 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
-?/. - c.-355-7086C>T likely benign r.(=) p.(=) Unknown g.112066191G>A - AMOT(NM_001113490.1):c.164C>T (p.(Pro55Leu)) - AMOT_000014 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.-355-6814C>G likely benign r.(=) p.(=) Unknown g.112065919G>C - AMOT(NM_001113490.1):c.436C>G (p.R146G) - AMOT_000029 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-355-6567A>G likely benign r.(=) p.(=) Unknown g.112065672T>C - AMOT(NM_001113490.1):c.683A>G (p.(His228Arg)) - AMOT_000028 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.-347A>C VUS r.(?) p.(=) Unknown g.112059097T>G - AMOT(NM_001113490.1):c.881A>C (p.(Gln294Pro), p.(=)) - AMOT_000013 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.-125G>A likely benign r.(?) p.(=) Unknown g.112058875C>T - AMOT(NM_001113490.1):c.1103G>A (p.(Arg368His), p.(=)) - AMOT_000027 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.-48_-46dup likely benign - - Unknown g.112058796_112058798dup - AMOT:NM_001113490.1:c.1195_1196insAGC, NM_133265.2:c.-33_-32insAGC - AMOT_000012 VKGL data sharing initiative Nederland; correct HGVS to be checked - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.-34_-33insAGC VUS r.(?) p.(=) Unknown g.112058783_112058784insGCT - AMOT(NM_001113490.1):c.1195_1196insAGC (p.(Gln398dup), p.(=)) - AMOT_000026 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.15G>A - r.(=) p.(=) Parent #1 g.112058736C>T - Q5Q - AMOT_000020 recurrent, found 4 times PubMed: Tarpey 2009 - - Germline - 4/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 4 Lucy Raymond
+?/. 7 c.699G>C - r.spl? p.(Gln233His) Unknown g.112035060C>G g.112791832C>G NM_001113490.1:c.1926G>C - AMOT_000003 - PubMed: Bosch 2016, Journal: Bosch 2016 - - De novo - - - 0 - DNA SEQ-NG - - CVI, ID - PubMed: Bosch 2016, Journal: Bosch 2016 - F no Netherlands - - 0 - - 1 Danielle Bosch
?/. - c.726C>T - r.(=) p.(=) Parent #1 g.112033984G>A - N242N - AMOT_000019 recurrent, found 2 times PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
-?/. - c.1014-8G>A likely benign r.(=) p.(=) Unknown g.112024354C>T - AMOT(NM_001113490.1):c.2241-8G>A (p.(=)) - AMOT_000011 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1121G>A VUS r.(?) p.(Arg374Gln) Unknown g.112024239C>T - AMOT(NM_001113490.1):c.2348G>A (p.R783Q) - AMOT_000010 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1203C>A - r.(=) p.(=) Parent #1 g.112024157G>T - I401I - AMOT_000018 recurrent, found 18 times PubMed: Tarpey 2009 - - Germline - 18/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 18 Lucy Raymond
?/. - c.1229G>A VUS r.(?) p.(Ser410Asn) Unknown g.112024131C>T - AMOT(NM_001113490.1):c.2456G>A (p.S819N) - AMOT_000009 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1247-169C>T - - p.(=) Maternal (inferred) g.112023077G>A g.112779849G>A - - AMOT_000002 - - - - Germline - - - - - DNA SEQ-NG-I - - CHTE - PubMed: Sun 2011, Journal: Sun 2011 - M no Netherlands - - 0 - - 1 Yu Sun
?/. - c.1261G>A - r.(?) p.(Gly421Arg) Parent #1 g.112022894C>T - - - AMOT_000017 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
-?/. - c.1261G>A likely benign r.(?) p.(Gly421Arg) Unknown g.112022894C>T - AMOT(NM_001113490.1):c.2488G>A (p.(Gly830Arg), p.(Gly421Arg)) - AMOT_000017 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1271G>A VUS r.(?) p.(Arg424His) Unknown g.112022884C>T - AMOT(NM_001113490.1):c.2498G>A (p.R833H) - AMOT_000025 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1382C>T likely benign r.(?) p.(Thr461Met) Unknown g.112022773G>A - AMOT(NM_001113490.1):c.2609C>T (p.T870M) - AMOT_000008 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1438G>A VUS r.(?) p.(Ala480Thr) Unknown g.112022717C>T - AMOT(NM_001113490.1):c.2665G>A (p.A889T) - AMOT_000007 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1456G>A likely benign r.(?) p.(Ala486Thr) Unknown g.112022699C>T - AMOT(NM_001113490.1):c.2683G>A (p.(Ala895Thr), p.(Ala486Thr)) - AMOT_000024 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1465_1466insTGCCGCCATCACTGC likely benign r.(?) p.(Ala489delinsValProProSerLeuPro) Unknown g.112022689_112022690insGCAGTGATGGCGGCA - AMOT(NM_001113490.1):c.2693_2694insTGCCGCCATCACTGC (p.(Ala894_Ala898dup), p.(Ala485_Ala489dup)) - AMOT_000023 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1511_1537del VUS r.(?) p.(Val504_Pro512del) Unknown g.112022631_112022657del - AMOT(NM_001113490.1):c.2738_2764del (p.(Val913_Pro921del), p.?, p.(Val504_Pro512del)) - AMOT_000006 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
?/. - c.1511_1537del - r.(?) p.(Val504_Pro512del) Unknown g.112022618_112022644del - 1511_1537delTTGCTGTTGCTGCTGCTGCTGCTCCAG;V504_A513>A - AMOT_000006 variant and/or predicted effect could not be not confirmed by curators PubMed: Tarpey 2009 - - Germline - 2/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 2 Lucy Raymond
?/. - c.1576A>G - r.(?) p.(Thr526Ala) Parent #1 g.112022579T>C - - - AMOT_000016 found once, nonrecurrent change PubMed: Tarpey 2009 - - Germline - 1/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 1 Lucy Raymond
?/. - c.1625C>T VUS r.(?) p.(Ala542Val) Unknown g.112022530G>A - AMOT(NM_001113490.1):c.2852C>T (p.(Ala951Val), p.(Ala542Val)) - AMOT_000005 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1706_1723del likely benign r.(?) p.(Pro569_Ala574del) Unknown g.112022442_112022459del - AMOT(NM_001113490.1):c.2933_2950del (p.(Pro978_Ala983del), p.(Pro569_Ala574del)) - AMOT_000022 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
-?/. - c.1730C>T likely benign r.(?) p.(Pro577Leu) Unknown g.112022425G>A - AMOT(NM_001113490.1):c.2957C>T (p.(Pro986Leu), p.(Pro577Leu)) - AMOT_000004 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - 0 - - - - - - - - - - - - - - - - - - -
-?/. - c.1817C>T likely benign r.(?) p.(Ala606Val) Unknown g.112022338G>A - AMOT(NM_001113490.1):c.3044C>T (p.A1015V) - AMOT_000021 VKGL data sharing initiative Nederland - - - CLASSIFICATION record - - - - - - - - - - - - - - - - - - - - - - -
?/. - c.1855_1857dup - r.(?) p.(Pro619dup) Parent #1 g.112022298_112022300dup - 1857_1858insCCT;K619_A620insP - AMOT_000015 recurrent, found 5 times PubMed: Tarpey 2009 - - Germline - 5/208 cases - 0 - DNA SEQ - - MRX;IDX 19377476-Pat? PubMed: Tarpey 2009 - M - - - - 0 for details contact Lucy Raymond (flr24 @ cam.ac.uk) - 5 Lucy Raymond